ID: 1153022760

View in Genome Browser
Species Human (GRCh38)
Location 18:646368-646390
Sequence AGTAGATGCTAAAAAGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153022760_1153022763 -2 Left 1153022760 18:646368-646390 CCAATATCTTTTTAGCATCTACT 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1153022763 18:646389-646411 CTAAGTTTAGATACGGGAACTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1153022760_1153022761 -9 Left 1153022760 18:646368-646390 CCAATATCTTTTTAGCATCTACT 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90
1153022760_1153022762 -8 Left 1153022760 18:646368-646390 CCAATATCTTTTTAGCATCTACT 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153022760 Original CRISPR AGTAGATGCTAAAAAGATAT TGG (reversed) Intronic
900772919 1:4560138-4560160 AGTAGATGCTTAATAAAAATGGG + Intergenic
901775704 1:11559256-11559278 AGTAGGTGCTCAATAAATATCGG + Intergenic
905097343 1:35484999-35485021 AATAGCTGTTAAAAAAATATGGG - Intronic
906650001 1:47506233-47506255 AGTAGGTGCTCAATAAATATTGG - Intergenic
908018380 1:59872091-59872113 ATTAGATGCTCAACAAATATAGG - Intronic
908440479 1:64148915-64148937 AGTAGAAGCTCAACATATATTGG - Intronic
909428929 1:75563314-75563336 AGAAGATGATGAAAAGATAAGGG + Intronic
909539312 1:76772870-76772892 AGTAGATGCTGAAAATAGATAGG + Intergenic
909863532 1:80637484-80637506 AGTAGATGGGAAAGAGACATAGG + Intergenic
910005733 1:82394576-82394598 AGTAGTTGCTTAATAGATATTGG + Intergenic
910847435 1:91616967-91616989 AGTAGATTCAAAAATGATAAAGG - Intergenic
911146991 1:94561960-94561982 AGTAGGTGCTCAACAAATATTGG + Intergenic
911866983 1:103039878-103039900 AGTAGATGCTGTAGAAATATTGG + Intronic
914946342 1:152070049-152070071 ATTAGATGTAAAAAAGATTTAGG - Intergenic
915780109 1:158539295-158539317 AGTAGATGCAGAAAATGTATTGG - Intergenic
915967228 1:160321109-160321131 AGCAGATGCTGAAAAAACATTGG + Intronic
916904033 1:169262381-169262403 AATAGAGGCTAAAAAGAAAAAGG - Intronic
917070763 1:171148213-171148235 AGCAGATGCTCAACAAATATTGG + Intronic
917249005 1:173036822-173036844 AGTAGATACAAATAAGATAAAGG + Intergenic
917915536 1:179697601-179697623 AATAGATGCAAAAATGATAAAGG + Intergenic
919127862 1:193417884-193417906 AGTGGACGTTAAAAAGATTTAGG - Intergenic
920205633 1:204289195-204289217 AGTAAATGCTCAATAAATATAGG - Intronic
920846123 1:209594338-209594360 GGTAGGTGCTAAATACATATTGG + Intronic
921279548 1:213552032-213552054 ATTCCATGCTAAAAAGAAATGGG - Intergenic
921970100 1:221138221-221138243 AGCATATTTTAAAAAGATATGGG + Intergenic
923292588 1:232560985-232561007 AGTAGATTCTTAATAAATATTGG - Intronic
1063565142 10:7166494-7166516 AGTAGATGCTCAATAAATATTGG - Intronic
1063937453 10:11093131-11093153 AGCAGATGCAAAAAAGCTAGAGG - Intronic
1065147465 10:22784085-22784107 AGTAGATATTAAAAAAACATAGG - Intergenic
1065761140 10:28984385-28984407 AGTAGAAGCTCAATAAATATGGG + Intergenic
1066693709 10:38059521-38059543 GGTAGATGATAAAAAGGAATTGG + Exonic
1068420351 10:56783184-56783206 AGTAGAAACTAAAAGGATATAGG - Intergenic
1068514269 10:58006491-58006513 AGTAGCTGCCAAAAAGTCATTGG - Intergenic
1068813333 10:61281382-61281404 AGTAGATGCTCAATAAATATAGG - Intergenic
1069123629 10:64601660-64601682 AAAAGATGCTAAATAGATTTAGG - Intergenic
1069617549 10:69815749-69815771 AGTAGGTGCTCAATAAATATTGG - Intronic
1070678856 10:78434829-78434851 AGGACATGCTAAAAAATTATTGG + Intergenic
1070738311 10:78881669-78881691 AGTAGATTTTTAAAAAATATTGG - Intergenic
1071157283 10:82705685-82705707 TGTAGATGGTAAAAGGATAAAGG - Intronic
1072212467 10:93259117-93259139 AGTAGGTGCTCAAAATATATGGG - Intergenic
1072309740 10:94142909-94142931 AGTAGATGTTCAACAAATATTGG - Intronic
1073750112 10:106515811-106515833 AGAAGAGACTAAAAAGAGATAGG - Intergenic
1074203329 10:111259000-111259022 AGTAGATGCTCAATATACATTGG + Intergenic
1074247724 10:111711953-111711975 AGTAGATACTAGATAAATATTGG - Intergenic
1074265657 10:111900632-111900654 AGTAGATGCCAAGAAGAGACAGG + Intergenic
1074935395 10:118174105-118174127 AGTTGAAGCTAAGAAGATAAGGG + Intergenic
1075005600 10:118827733-118827755 AGTAGGTGCGAAACAGATGTTGG + Intergenic
1076593803 10:131611467-131611489 AGAACATGCCAAAAAGACATGGG - Intergenic
1077074136 11:692482-692504 AGCAGATGCTTAAAAGATACTGG + Intronic
1077639038 11:3864594-3864616 ATTAGATGATAAAAAGATGGAGG - Intronic
1077969045 11:7168344-7168366 AGTAGCTGCTGAATAGATATTGG + Intergenic
1078512147 11:11993008-11993030 AGTTGATGCTAAAAATAAAATGG + Intronic
1078820397 11:14874520-14874542 AGCAGATACTATAAAGAAATGGG - Intergenic
1079025517 11:16944810-16944832 AGTAAATGCTTAATAAATATTGG - Intronic
1079415053 11:20226423-20226445 AGTAAATGAAAAAAAGAAATTGG + Intergenic
1081516096 11:43831671-43831693 AAAAGCTGCTAAAAAGATTTGGG + Intronic
1082010390 11:47446522-47446544 AGTAGATGCTTAATAAATCTTGG - Intronic
1083852780 11:65377695-65377717 AGCAGATGCTACACAGATTTGGG + Intronic
1084022453 11:66425856-66425878 AGTATAGGCTTCAAAGATATTGG - Intronic
1084572040 11:69965741-69965763 AGTAGGTGCTCAAAAAATGTTGG - Intergenic
1084789722 11:71466170-71466192 AACATATGCTAAAAAGACATGGG - Intronic
1084862170 11:72026340-72026362 AGTAGGTGCTCAATACATATGGG + Intronic
1085227770 11:74937978-74938000 AGTAGATGCTCAGAAAAGATAGG - Intronic
1085526036 11:77164692-77164714 AATAGATGCTAAGAGCATATTGG - Intronic
1085831626 11:79907153-79907175 AGAAGCTACTAAAAAGATAAAGG + Intergenic
1086155310 11:83659146-83659168 AGTAAATGCTTAAAATATGTTGG - Intronic
1086177276 11:83906513-83906535 AGTAGATGCTAATAATATTTTGG - Intronic
1086390097 11:86354688-86354710 AGGAGATGGTAAAAAAATTTTGG - Intergenic
1086564892 11:88214087-88214109 AGTAGGTGCTAAACAAATGTTGG - Intergenic
1086605507 11:88691512-88691534 AGTCAATGATAAAGAGATATTGG - Intronic
1087114065 11:94504620-94504642 AGTAGATGCTAAAACCACTTTGG - Intergenic
1087265035 11:96051188-96051210 TGTAGATTCTAAATAAATATTGG - Intronic
1087689750 11:101306486-101306508 ATTATATTCTAAAAAGATATGGG - Intergenic
1089883633 11:121798410-121798432 AGTAGACTCTAAATAGATCTTGG + Intergenic
1091913336 12:4249805-4249827 AGTAGTTGTTCAAAAGATGTGGG - Intergenic
1093824968 12:23673108-23673130 AGAAAATGGTGAAAAGATATGGG + Intronic
1095232984 12:39764104-39764126 AGAAAATGGTAAAAAGATGTAGG - Intronic
1095462490 12:42457264-42457286 AGTACATTCTCAAAAGATAGGGG - Exonic
1096739290 12:53680290-53680312 AGCAGATGCTCAATAAATATTGG - Intergenic
1096798129 12:54091244-54091266 AGCAGATGCTCAAAACACATGGG - Intergenic
1096864452 12:54553750-54553772 GGGTGATGCTTAAAAGATATGGG + Intronic
1096932460 12:55227968-55227990 AGTAAAAGCTAGAAAAATATTGG - Intergenic
1096932467 12:55228088-55228110 AGTAAAAGCTAGAAAAATATTGG - Intergenic
1097159208 12:57034364-57034386 AGTAGATGTTCAAAAGATAATGG + Intronic
1097750850 12:63350548-63350570 AGAAGTTGCTACAAAGAGATGGG + Intergenic
1101584590 12:106074130-106074152 AGTGGATGATACAAAGATAAGGG - Intronic
1102112561 12:110375490-110375512 AGTAAATGCTAAATAAATAGTGG - Intronic
1102389011 12:112534803-112534825 AGCAGATGCTCAATAAATATGGG - Intergenic
1102744325 12:115236973-115236995 AGTAGGTGCTCAATAAATATTGG - Intergenic
1103474124 12:121205970-121205992 ACTAGATCCTTAACAGATATAGG + Intergenic
1104066227 12:125309477-125309499 AGTAGGTGCTCAGAAAATATCGG - Intronic
1106201154 13:27538449-27538471 AGTAGATGCTAAGAGAACATTGG + Intergenic
1106337752 13:28799143-28799165 AGGAGATGCTCAATAAATATTGG - Intergenic
1106482782 13:30149304-30149326 AGTAGATGCTCAATAAATATAGG - Intergenic
1106780614 13:33055866-33055888 AGAAGATGCTCAATAAATATTGG - Intronic
1106938878 13:34754230-34754252 AGATGATGCTAGAAAGATACGGG - Intergenic
1106965891 13:35066538-35066560 ACTAGATATTAAAAAGACATTGG - Intronic
1107134097 13:36925244-36925266 AGTAGGTGCTCAATAAATATTGG + Intergenic
1107670967 13:42745932-42745954 ATTAGATGCTGAAAACATATTGG + Intergenic
1108217205 13:48196941-48196963 TGGAGATAGTAAAAAGATATTGG - Intergenic
1108310392 13:49183895-49183917 AGTAGATGCTCAACAGATATTGG - Intronic
1108976476 13:56450426-56450448 AGTAAATGCTAAATAAATAATGG - Intergenic
1109020906 13:57091822-57091844 AGTAGATACATAAAAGATAAAGG - Intergenic
1109291718 13:60483664-60483686 AGTAGATTCTTATAAGAAATAGG - Intronic
1109407092 13:61915842-61915864 TTTAAATGCCAAAAAGATATGGG + Intergenic
1109691777 13:65903297-65903319 AGAAGATTCTAAAAAGATACTGG + Intergenic
1109938049 13:69319569-69319591 AATAGATGCTAAAAACATTTGGG - Intergenic
1110821072 13:79917004-79917026 AGTAGATGCTCAATAAATATTGG + Intergenic
1110865881 13:80395623-80395645 ACTAGAAGCTAAAAAAAGATAGG + Intergenic
1111098222 13:83542754-83542776 AGTAGATGCTCAATAAATATTGG + Intergenic
1112153419 13:96790566-96790588 AGTAGAAACTTAAAAAATATTGG - Intronic
1112271119 13:97970927-97970949 AGTAAATGCTTAATAGATAGTGG - Intronic
1112845453 13:103636984-103637006 AGTAAAAGCTAAGAAAATATGGG + Intergenic
1114074616 14:19150783-19150805 ACTAGATATTAAAAAGACATTGG - Intergenic
1114087651 14:19249192-19249214 ACTAGATATTAAAAAGACATTGG + Intergenic
1114591646 14:23870316-23870338 AATAGATGCTAAATAAATATTGG + Intergenic
1114789779 14:25644676-25644698 AAGAGATGCTATAAAGTTATTGG + Intergenic
1115472389 14:33781929-33781951 AGTAGATGCTCTAAAGTTCTTGG - Intronic
1116259103 14:42600235-42600257 ATTAGATGCTAGAAAGAAACTGG + Intergenic
1116329818 14:43581437-43581459 TGTGGATGCTAAAAAGTTTTAGG - Intergenic
1117760053 14:59017451-59017473 AGTATCTGCTAAAAACATGTTGG + Intergenic
1118232729 14:63968476-63968498 AGTAGATGCTTGAAAGAAGTAGG + Intronic
1121839361 14:97119855-97119877 AGTAGAGGCTATAGAGGTATAGG - Intergenic
1123922200 15:25078112-25078134 AGTAGATGCTACCACGACATGGG - Intergenic
1125088264 15:35757902-35757924 AGGACATGCTAAAAAGCTTTGGG + Intergenic
1125884280 15:43216816-43216838 AGTAGGTGCGAGAAAGATTTTGG - Intronic
1126506495 15:49410131-49410153 AGTGGATGCAAAAAATAAATAGG - Intronic
1128386470 15:67152733-67152755 AAAAGATGCTACAAAGATCTGGG - Intronic
1133610621 16:7430055-7430077 AGTACATGCTCAAAACAAATTGG + Intronic
1134361403 16:13534140-13534162 TGTAAATGGTAAAAAGAAATGGG - Intergenic
1135153913 16:20035937-20035959 AGTAGATGCTAAATACTTTTTGG - Intronic
1135274341 16:21098522-21098544 AGTAGATGCTATTAGGAAATAGG + Intronic
1135900013 16:26449040-26449062 AATAAATGCAGAAAAGATATTGG - Intergenic
1138081064 16:54091937-54091959 AGTAGATGCTCAGAAAATGTTGG + Intronic
1141247079 16:82317941-82317963 AGTAGGTGCTAGAAAGTTCTTGG + Intergenic
1141943168 16:87291993-87292015 AGAAGATGCTTAAAAGAAATGGG - Intronic
1144842721 17:18198166-18198188 AGGTGATGCTAAAAAGCTAAAGG - Intronic
1148571265 17:48671299-48671321 AGTAAGTGCTCAAAAGATGTTGG + Intergenic
1148857903 17:50589049-50589071 AGTAGCTGCTCAAAAAGTATGGG - Intronic
1153022760 18:646368-646390 AGTAGATGCTAAAAAGATATTGG - Intronic
1153111904 18:1601005-1601027 AGTAGACGCTCAAGAAATATTGG - Intergenic
1154453338 18:14499093-14499115 ACTTGAGGCTAAAAAGATGTTGG - Intergenic
1156482298 18:37443911-37443933 AATAGATGCTAAAAATTTAGAGG + Intronic
1157369338 18:47096035-47096057 AGCAAATGCAAAAAAGAAATAGG + Intronic
1157415390 18:47498076-47498098 AGGAGATCCCAAAAAGATCTGGG + Intergenic
1158849776 18:61483681-61483703 AGTAGATGCTCAATAAATATTGG - Intronic
1159041773 18:63330880-63330902 AGTAGATGCTAAAATGGGATAGG + Exonic
1159093706 18:63877652-63877674 AGAGGATGATAAAAAGATGTAGG + Intronic
1159510449 18:69391850-69391872 AGAAGATGATGAGAAGATATGGG - Intergenic
1159885563 18:73900906-73900928 AGTAGGTGCTCAAAAGAGACTGG - Intergenic
1161778447 19:6276609-6276631 AGCAGATGCCGAAAAGAGATTGG - Intronic
1162754631 19:12850102-12850124 AGTAGGTGCTTAATAAATATTGG - Intronic
1163028908 19:14530637-14530659 AGTAAATGCAAAACAGATAGGGG + Intronic
1163491325 19:17618651-17618673 AGCAGGTGCTCAAAAAATATTGG + Intronic
1168302190 19:55411570-55411592 AGTAGGTGCTCAATAAATATTGG - Intergenic
925524907 2:4788659-4788681 AGAAGAAGATAGAAAGATATGGG - Intergenic
928158713 2:28901151-28901173 ACTTTATGCTAAAAACATATAGG + Intronic
928219866 2:29394799-29394821 AGATGGTGCTAAAAAGTTATTGG - Intronic
928937121 2:36690136-36690158 AGGAAATGCTCAAAAGATAATGG - Intergenic
929071979 2:38039905-38039927 AGGAGATGCTAAAAAGTAGTAGG - Intronic
929230861 2:39558428-39558450 AGGAGATATTAAAAAGATTTTGG + Intergenic
930624667 2:53683192-53683214 AATTGATGCTGAAAAAATATCGG - Intronic
931015236 2:57970564-57970586 AGTCAATGATAAAAGGATATTGG + Intronic
931770665 2:65494576-65494598 ATTCAATGCTAAAAAGAAATGGG - Intergenic
931792512 2:65677119-65677141 AGCAGCAGCTAAAAAGATAATGG - Intergenic
932692237 2:73922797-73922819 AGTAGATGCTCAGCAAATATTGG + Intergenic
933154145 2:78952830-78952852 AGAAGATGATAAAAACATAAAGG + Intergenic
933460992 2:82585194-82585216 AGTAGATGTTTAAAAATTATTGG - Intergenic
933911390 2:86943708-86943730 TGTTGATGTTAAAAGGATATTGG + Intronic
934514762 2:94979845-94979867 AGTAGCTGCTCAACAAATATTGG - Intergenic
934830900 2:97523501-97523523 AGTATATGCTATAAATATTTTGG - Intronic
935008845 2:99111801-99111823 AGTAGACACTAAAAAGATACAGG + Intronic
935547168 2:104412903-104412925 AATAGAAGCTAAAAAGAGAAAGG + Intergenic
935612945 2:105044753-105044775 AGAAGATGCTAAAATGTTGTAGG + Intronic
935762219 2:106331877-106331899 AGTTGATGGTAAAAAGTTTTAGG + Intergenic
935991260 2:108720743-108720765 TGTTGATGTTAAAAGGATATTGG + Intronic
936427161 2:112431938-112431960 TGTTGATGTTAAAAGGATATTGG - Intronic
936738637 2:115476528-115476550 AGTAGAAGCAAAAAAGTTAGGGG + Intronic
937256311 2:120558283-120558305 ATTAGATGCTGAAAACAGATTGG - Intergenic
937718561 2:125063535-125063557 GGTAGATGCTTATTAGATATTGG - Intergenic
938126314 2:128674854-128674876 AATAGATAATAAAAAGATAATGG + Intergenic
938488947 2:131747275-131747297 ACTAGATATTAAAAAGACATTGG - Intronic
939122809 2:138138309-138138331 AGCAGATGCTTAATAGATAATGG + Intergenic
940356524 2:152749366-152749388 AGTAGATGGAAGAAAGAAATGGG - Intronic
940416749 2:153431752-153431774 ATTAGATGTTTAAAAGAAATGGG - Intergenic
940513851 2:154654333-154654355 AGCAGATGCTTAAAAAATATTGG - Intergenic
942495093 2:176531863-176531885 AGGACATGTTAAAATGATATGGG - Intergenic
942912131 2:181257007-181257029 AGTAGATGCTCAATAAATATTGG - Intergenic
944281664 2:197904969-197904991 ATTAGATGCTAAAAAAGTTTTGG - Intronic
945365358 2:208946239-208946261 AGAAGATGCTAAAGGGAAATTGG + Intergenic
945395756 2:209314302-209314324 AGTAGAAGGTAACAAGATTTTGG + Intergenic
945404192 2:209424629-209424651 AGTGGATTCTACAAAGATAGTGG + Intronic
946060806 2:216939950-216939972 AGGAGATGGTCAAAAGAAATTGG - Intergenic
947220630 2:227788454-227788476 AGTGAATGCTAAACACATATCGG - Intergenic
947339912 2:229127399-229127421 AGTAGAGGCTATAAACTTATCGG + Intronic
947740654 2:232483363-232483385 AGTAGGTGCTCAATATATATGGG + Intronic
1169254220 20:4085087-4085109 AGTAGATGCTAAATAAATACTGG + Intergenic
1169644401 20:7793539-7793561 AATAGATGCAGAAAATATATGGG - Intergenic
1171319213 20:24224576-24224598 AGAAGTTTCTAAAAAGATTTTGG - Intergenic
1171849954 20:30301064-30301086 AGCAGATGCTCAAAACACATGGG - Intergenic
1176442698 21:6789197-6789219 ACTTGAGGCTAAAAAGATGTTGG + Intergenic
1176820850 21:13654194-13654216 ACTTGAGGCTAAAAAGATGTTGG + Intergenic
1177400334 21:20595166-20595188 AGAAGTAGCTAAAAAGATAAGGG + Intergenic
1177400339 21:20595207-20595229 AGAAGTAGCTAAAAAGATAAGGG + Intergenic
1180290264 22:10843723-10843745 ACTAGATATTAAAAAGACATTGG - Intergenic
1180493062 22:15873144-15873166 ACTAGATATTAAAAAGACATTGG - Intergenic
1181455977 22:23060511-23060533 AGTAGGTGCTCAAGAAATATTGG - Intronic
1181619264 22:24077355-24077377 AGTAGGTGCTTAATAAATATGGG + Intronic
1182806722 22:33078371-33078393 AGTAGGTGCTCAATAAATATTGG - Intergenic
949230529 3:1744850-1744872 AGAAGAAGATAAAAAGATGTGGG - Intergenic
949901966 3:8822682-8822704 AGTAAATGCTAACAAAATGTCGG - Intronic
950130183 3:10538143-10538165 AGTAGCTCCTTAAAATATATTGG + Intronic
950733046 3:14979492-14979514 AGTAAATGCTATAAAGAAAAGGG + Intronic
952962225 3:38599377-38599399 AGTACATGCAAAAATGATCTGGG + Intronic
953416882 3:42726956-42726978 AGTAGATGATAAAAAACAATAGG + Intronic
955041840 3:55324973-55324995 AATAGATGCTCAATAAATATTGG - Intergenic
955311291 3:57889282-57889304 ACTAGAGGCTATAATGATATTGG + Intronic
955547781 3:60050220-60050242 AGTACAAGCTAAGAAAATATTGG - Intronic
956347262 3:68294347-68294369 ATTACATGTTAAAATGATATTGG - Intronic
957318533 3:78599430-78599452 AGTAGAAGCTGAAAAGGTATAGG - Intronic
959301207 3:104604277-104604299 TGTAAATGCTAAGAAGATAAGGG - Intergenic
959487592 3:106945226-106945248 AGAAGACTATAAAAAGATATTGG - Intergenic
959510531 3:107206597-107206619 ATTAGGTGCTTAAAATATATGGG - Intergenic
959958250 3:112265467-112265489 ATAAGAAGCTTAAAAGATATAGG - Intronic
959976932 3:112471366-112471388 AGTAAATGCTAAAGAGAGTTAGG + Intronic
960180882 3:114576091-114576113 AGTAGGTGCTTAATAAATATTGG - Intronic
960218862 3:115078935-115078957 AGTTGAAGCTTAAAAGTTATTGG + Intronic
961335569 3:126177366-126177388 AGTCAATGATAAAAAGAAATGGG + Intronic
962214153 3:133505418-133505440 AATAGATCCTAAAAAGATTTTGG + Intergenic
962866536 3:139452100-139452122 AGCAGATGCTAACTAGAGATAGG - Intergenic
963132469 3:141871517-141871539 AGAAGATGTGAAAAAGAAATTGG - Intergenic
965488197 3:169304783-169304805 AGAGGAAGTTAAAAAGATATAGG - Intronic
965512775 3:169587152-169587174 ATTAGATGCTCAATAAATATTGG - Intronic
965875268 3:173310053-173310075 TGTAAATGCTAGAAAGAGATAGG - Intergenic
967671468 3:192240225-192240247 AGTATATGGTAATTAGATATGGG - Intronic
968851184 4:3079647-3079669 TGTAGATGGAATAAAGATATTGG + Intronic
969926744 4:10592668-10592690 AGTAGATGCTCAAGAAACATTGG - Intronic
970044548 4:11836720-11836742 AGTAGGTGCTAAATATATAGTGG + Intergenic
970711990 4:18874863-18874885 AGAAGATTATAAAAAGACATGGG - Intergenic
970986416 4:22164035-22164057 ATTAGATGCTTAATATATATTGG - Intergenic
970998309 4:22293255-22293277 AGCAGATGTGAAAAAGATAAAGG + Intergenic
970999490 4:22305979-22306001 AGTAGGTGCTCAATACATATTGG - Intergenic
971031796 4:22645712-22645734 AGTTGATGCTGAATAAATATTGG + Intergenic
971364601 4:25967723-25967745 AGTTGATGATAAACAGACATAGG + Intergenic
971545259 4:27878386-27878408 ATTGGATGTTAAAAAGCTATTGG - Intergenic
972608782 4:40637996-40638018 AGTAGATGCTTGAAAAATGTTGG - Intergenic
972997337 4:44897192-44897214 AGTAGTTGCTTAATAAATATTGG - Intergenic
973295562 4:48516330-48516352 GGTAGAGGCTCAAGAGATATTGG + Intronic
973998898 4:56490085-56490107 TGTAGACACTAAATAGATATAGG + Intronic
974395759 4:61333165-61333187 AGTAAATGAAAAAAATATATTGG + Intronic
975081516 4:70285956-70285978 AGAAGAGGCTAAAAAGGTATTGG - Intergenic
976337426 4:83906450-83906472 AGTAAATGTTCAAAAGATTTTGG + Intergenic
978050676 4:104195641-104195663 AGTAGATGATGAAAAAGTATTGG + Intergenic
978500559 4:109404885-109404907 GGCAGATGCTAAAGAAATATAGG + Intergenic
979302002 4:119096932-119096954 AGCAGTTTCTAAAAAGATAATGG - Intergenic
980725326 4:136751516-136751538 AGTAAATGCTATAAAGTTAGAGG + Intergenic
981636129 4:146881881-146881903 AGTAGCTACTCAAAAGTTATGGG - Intronic
981641901 4:146954015-146954037 TGAAGATGCTAAAAAAAAATTGG - Intergenic
981647420 4:147016450-147016472 ATAAGATGCTAAATAAATATTGG - Intergenic
981950068 4:150395593-150395615 AGGAACTGCTAAAAAGACATGGG - Intronic
982363354 4:154548358-154548380 AGTAGATTTTAAAAAGGTAAAGG + Intronic
982463169 4:155696489-155696511 AGTTGATGCTAAGAACATTTTGG + Intronic
983269323 4:165543023-165543045 AGTACATGCTAAATAAATGTGGG - Intergenic
983278250 4:165644905-165644927 AGCAGATGCTGAAAAGATTTAGG - Intergenic
984079253 4:175223449-175223471 AGTGGATGCTTAATAAATATTGG - Intergenic
984371307 4:178869770-178869792 GGTATATGCTAAACTGATATAGG - Intergenic
984371312 4:178869815-178869837 AGTATATGCTAAACTGATATGGG - Intergenic
984680597 4:182604800-182604822 ACTAGAAGGTAAAAAGCTATGGG - Intronic
985940246 5:3129536-3129558 AGTATTTGCGAAAAAGATAAAGG - Intergenic
987957444 5:24759017-24759039 AGTAGATACAAAAAAGGCATTGG - Intergenic
988851426 5:35184895-35184917 AGTAAATGCTCAACAAATATAGG + Intronic
989085318 5:37670228-37670250 AGTATATGCTGAAAGGATCTTGG + Intronic
989669535 5:43899277-43899299 AGTAGATGCTTAAGAAATACTGG + Intergenic
990411467 5:55545190-55545212 AGTAGGTGCTCAATAGATGTTGG + Intergenic
991064265 5:62409229-62409251 AATATATGCTCAAAAGTTATAGG - Intronic
991992530 5:72354729-72354751 AGTATATTCTAAAAATATACTGG + Intronic
992370622 5:76140153-76140175 AGTAGATGCTCAATAAATTTTGG - Intronic
993053007 5:82947303-82947325 AATAGATGCAAAAATGATAAAGG + Intergenic
993077804 5:83256214-83256236 ATTAGATGCTAGAAACATCTTGG + Intronic
993151208 5:84164684-84164706 AGTAGGTACTCAAAATATATTGG - Intronic
993346812 5:86794332-86794354 AGAAGAAGCAAAAAAGAGATGGG - Intergenic
994446943 5:99888076-99888098 AGAAGTTGCTAAAAAGAAAAAGG + Intergenic
994614165 5:102082337-102082359 AATAGATGCTGAAAAGATTTTGG + Intergenic
994812561 5:104540243-104540265 AGTAGGTGCTCAATAGTTATTGG + Intergenic
995902087 5:117081613-117081635 AGTAGAAGCTCAATACATATTGG - Intergenic
997022793 5:130021099-130021121 AGAAGATGCTACATAAATATTGG - Intronic
998635736 5:143952924-143952946 AGTATATGCTAAATAAATACCGG - Intergenic
998985638 5:147753183-147753205 AGTAGAAGCTCAATAAATATTGG + Intronic
999008175 5:148005483-148005505 AGTAGATGGGAAAGAGACATAGG + Intergenic
999198838 5:149801896-149801918 AGTAGATACTCAAAAGACAATGG - Intronic
1000483318 5:161806904-161806926 AGTTGATAATAAAAAGATTTGGG - Intergenic
1002824728 6:762714-762736 AGTAGGTGCTTAACAGATGTTGG - Intergenic
1004478017 6:15992142-15992164 AGTGGATGCTAAAAATAGGTAGG + Intergenic
1004641622 6:17521533-17521555 AGTAGATGCTTAAGCCATATTGG - Intronic
1005601992 6:27435991-27436013 AGAATATGCTAAATAGATAGTGG + Intergenic
1005728982 6:28677229-28677251 AGTAGATGATAAAAACAGCTGGG + Intergenic
1009853294 6:69226381-69226403 AGTAGGTGCTTAATAAATATTGG - Intronic
1010916132 6:81621473-81621495 AGTAGATGCTTAATAAATATTGG - Intronic
1010948034 6:82001319-82001341 ATTAGATGCACAAAAGATAAAGG + Intergenic
1011913977 6:92479102-92479124 AGTAGACACTAAAAAGATAAAGG + Intergenic
1012776580 6:103501987-103502009 AGTAAATTTAAAAAAGATATTGG - Intergenic
1013959607 6:115883309-115883331 AATAGATTCTAAACACATATGGG + Intergenic
1015004378 6:128260804-128260826 AGAAGATGCTGCAAAAATATAGG + Intronic
1015110245 6:129584906-129584928 AGTAGATGCTTAATAAATTTTGG - Intronic
1015389169 6:132661787-132661809 CGTAGATGCTTAATAAATATTGG + Intergenic
1015716415 6:136197025-136197047 GGTAGATGCTCAATAGATACAGG + Intergenic
1016022746 6:139253174-139253196 AGTAGATGCTCAGTAAATATTGG + Intronic
1016633622 6:146260928-146260950 TCTAGATGCTAAAAATATAGAGG - Intronic
1018356873 6:163027092-163027114 AGTAGATGTTTAAAAGATGCAGG - Intronic
1020954796 7:14727630-14727652 AGTAGATATTTAAAATATATTGG - Intronic
1022065357 7:26850023-26850045 AGTACATGATAAAAAAATTTGGG - Intronic
1022622300 7:31997341-31997363 AGTAGATGCTTAAGAAATGTTGG + Intronic
1022639104 7:32164686-32164708 AGCAGATGCTCAATAAATATTGG + Intronic
1022980955 7:35604563-35604585 AGTAATTGCTCAAAATATATGGG - Intergenic
1023726648 7:43149090-43149112 ATTAGAAGCTAAAAAGTTTTAGG + Intronic
1024221620 7:47293006-47293028 ACCAGTTGCTAAAAAGATAAGGG - Intronic
1024468723 7:49743035-49743057 AGTAGAGGCTGAAAAAATCTTGG + Intergenic
1025032039 7:55565685-55565707 AGCACATGTTAAAAAGATTTCGG + Intronic
1025238087 7:57248384-57248406 AGTAGATATTCAATAGATATTGG - Intergenic
1027461862 7:78464249-78464271 AGTAGAAGCTAAATAGAAGTGGG - Intronic
1028218822 7:88169603-88169625 AGCAGATGCTTAAAACCTATGGG + Intronic
1028452570 7:91002565-91002587 AGTAGATACTCAATACATATTGG - Intronic
1028604535 7:92641487-92641509 AGAAAATGCTCAAAAAATATGGG - Intronic
1029028714 7:97446174-97446196 AGAAGATATTCAAAAGATATTGG + Intergenic
1029370988 7:100150468-100150490 AGTTTATGCTGAAAAGATTTGGG + Intronic
1029962515 7:104703375-104703397 AGAAGATGCTAAAAACACAGTGG - Intronic
1030245772 7:107383489-107383511 AGTAGGTGCTAGAGAGACATAGG + Intronic
1031320081 7:120314083-120314105 AGTAGAAGCTCAAATGATGTTGG - Intronic
1031428146 7:121632990-121633012 AGTGGACGTTAAAAAGATATTGG + Intergenic
1032142234 7:129342366-129342388 AATAGATTTTAAAAATATATGGG + Intronic
1032466492 7:132148928-132148950 AGTAGGTGCTCAAAAAGTATTGG + Intronic
1032835417 7:135668276-135668298 ATTAGATGATGAAAAGATGTAGG - Intronic
1032893052 7:136220481-136220503 AGAAAAAGCTAAAAAAATATAGG + Intergenic
1034828516 7:154288714-154288736 AGTAGGTGCTCAATAAATATGGG - Intronic
1036024764 8:4893796-4893818 AACATATGCTAAAAAGACATTGG - Intronic
1036171836 8:6494288-6494310 AGTAGATGCTAGAAAGAATGTGG - Intronic
1036822047 8:11948824-11948846 AGTAAATGCTAAAATGACAGTGG - Intergenic
1037324711 8:17676923-17676945 AGTAAAAGTTAAAAATATATGGG - Intronic
1037345576 8:17897246-17897268 AGTAGAAACTAAAAATACATGGG - Intronic
1038991965 8:32877922-32877944 AGTAGGTGCTCAATAAATATTGG + Intergenic
1039169168 8:34722438-34722460 TGTAGTTTCTAAAAGGATATTGG + Intergenic
1040597036 8:48848368-48848390 AGTAGATTCTGATAATATATGGG + Intergenic
1042175156 8:66031452-66031474 AGTAGGTGCTTAAAAAAAATAGG - Intronic
1043217656 8:77615061-77615083 AGTAGATGCCTAATAAATATTGG + Intergenic
1044588387 8:93889557-93889579 ATTACATGCTAAAATGATACAGG - Intronic
1047056384 8:121169308-121169330 TGTAAATGCTATAAAGAAATCGG + Intergenic
1047326070 8:123837027-123837049 AGTAGAGGCTTAATATATATAGG + Intergenic
1047721273 8:127642431-127642453 GGAAGATGCTAAAAGAATATTGG - Intergenic
1049912933 9:287099-287121 AGTAGATGCTCAATAAATGTGGG - Intronic
1050856086 9:10357568-10357590 AGTAAATGCTGAAAACATACTGG + Intronic
1051034644 9:12728879-12728901 AGGTGATGCTAATAAAATATTGG - Intergenic
1051756044 9:20401980-20402002 AGAAGATGTAAAAAATATATTGG + Intronic
1051818798 9:21140825-21140847 AGTATATGTTAAAAAGACTTAGG - Exonic
1053787730 9:41664357-41664379 AGCAGATGCTCAAAACACATGGG - Intergenic
1054157396 9:61650410-61650432 AGCAGATGCTCAAAACACATGGG + Intergenic
1054176006 9:61875699-61875721 AGCAGATGCTCAAAACACATGGG - Intergenic
1054477170 9:65581415-65581437 AGCAGATGCTCAAAACACATGGG + Intergenic
1054661533 9:67705109-67705131 AGCAGATGCTCAAAACACATGGG + Intergenic
1055285044 9:74719718-74719740 AGTAGATGCTGGCAAGTTATAGG + Intergenic
1055751009 9:79504814-79504836 AGAAGGAGCTGAAAAGATATAGG + Intergenic
1056832195 9:89926056-89926078 AGTAGATGGTAGATAGATAGAGG - Intergenic
1057104430 9:92398425-92398447 AATACAGGCTAAAAAGAAATTGG - Intronic
1058026630 9:100147009-100147031 AGTAGGTGCTAAATATATGTTGG + Intronic
1058428173 9:104894288-104894310 AGCAGATGCTCAAAATATGTTGG + Intronic
1059155064 9:111982331-111982353 TGTAGATGCTAAGAAGAGCTTGG + Intergenic
1060681692 9:125571297-125571319 TGTAGATGATAAAAAGTTTTAGG - Intronic
1060795774 9:126511880-126511902 AGTTGATTCTGAAAGGATATGGG - Intergenic
1061166558 9:128926126-128926148 AGTAGATGCTCAATCAATATTGG + Intronic
1203526507 Un_GL000213v1:95363-95385 ACTTGAGGCTAAAAAGATGTTGG - Intergenic
1186234011 X:7487277-7487299 ATTAGCTGAGAAAAAGATATTGG + Intergenic
1186259571 X:7762386-7762408 AATAAATAATAAAAAGATATTGG + Intergenic
1187299402 X:18033140-18033162 AGTAAAAGGCAAAAAGATATGGG - Intergenic
1187426473 X:19181794-19181816 AGCAAATGCCAAAAAGAGATGGG + Intergenic
1188287293 X:28343355-28343377 AATAAATGCTAAAAAGAGACGGG - Intergenic
1188287427 X:28344499-28344521 AATACATGCTAAAAAGAGCTTGG - Intergenic
1188558390 X:31438629-31438651 AGGACATGCTAGAAAGACATCGG + Intronic
1188700148 X:33249493-33249515 AGTAAATGCAATAATGATATGGG - Intronic
1188801639 X:34538850-34538872 AGTATATGTTAAAATTATATTGG + Intergenic
1189532353 X:41899541-41899563 AGTAGATTCACAAAAGATAAAGG - Intronic
1190450821 X:50578874-50578896 AGGAGATGCTGCAAAGACATGGG + Intergenic
1191239379 X:58170314-58170336 AGTAGATTCTACAAAAATAAGGG - Intergenic
1191878739 X:65823229-65823251 TGTTGCTGCTAAAAAGAAATTGG + Intergenic
1192623866 X:72707822-72707844 AATAGATGTTAAAAAGAAAATGG - Intronic
1192798267 X:74442548-74442570 AGTAAATGCTCAATAAATATTGG - Intronic
1194056386 X:89138970-89138992 AGTAGATGCTAAAGTTTTATTGG - Intergenic
1194070990 X:89325963-89325985 ACTAGAAGCTGAGAAGATATTGG + Intergenic
1194638345 X:96373105-96373127 AGTAGGTGCTTAAACGGTATTGG - Intergenic
1194683252 X:96880032-96880054 AGTAGACGTTAAAAATATACTGG - Intronic
1195693229 X:107646474-107646496 AATAGGTGCTAAAAAAAAATTGG + Intronic
1196485733 X:116204475-116204497 AGTAGATGCTAACATGATGATGG + Intergenic
1197609819 X:128625282-128625304 AGTAGATGCTAAAAGGGGAAAGG - Intergenic
1197896499 X:131321034-131321056 AGTAGAGGCTAGAAAAATAGAGG - Intronic
1198001505 X:132443502-132443524 AGTAGATGCTAGATAAATGTTGG - Intronic
1198033506 X:132778688-132778710 AGTAGAAGGTAAAAACATTTTGG - Intronic
1198431396 X:136570339-136570361 AGTAGGTGCTAAATAAATGTTGG - Intergenic
1199802010 X:151261025-151261047 AGTAAATGCTCAATAGTTATTGG - Intergenic
1201668791 Y:16491527-16491549 ATTATATGCTAAAAAGAAAAGGG + Intergenic
1201691502 Y:16771275-16771297 AATAGATGATAAACAGATATAGG - Intergenic
1202082825 Y:21102328-21102350 GGTAGATGCTAACTAGAGATTGG + Intergenic