ID: 1153022761

View in Genome Browser
Species Human (GRCh38)
Location 18:646382-646404
Sequence GCATCTACTAAGTTTAGATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153022760_1153022761 -9 Left 1153022760 18:646368-646390 CCAATATCTTTTTAGCATCTACT 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90
1153022758_1153022761 25 Left 1153022758 18:646334-646356 CCTTTTTTTTTTTCTAGTTGTAT 0: 1
1: 0
2: 25
3: 368
4: 3540
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90
1153022759_1153022761 -5 Left 1153022759 18:646364-646386 CCAACCAATATCTTTTTAGCATC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153022761 Original CRISPR GCATCTACTAAGTTTAGATA CGG Intronic
903087680 1:20877520-20877542 GCACCTACTAAGTTGCAATATGG - Intronic
905056089 1:35095076-35095098 GCATAGATCAAGTTTAGATATGG + Intronic
908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG + Intronic
911784682 1:101931622-101931644 GCATCTGCTCAGTATAGCTATGG - Intronic
912261874 1:108118870-108118892 GCATCTAAAAGCTTTAGATAAGG + Intergenic
913404759 1:118477200-118477222 TCATCTACTAAGTTTCGAAGTGG + Intergenic
1064612981 10:17123129-17123151 GATTCTATTATGTTTAGATAAGG - Intronic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1065549191 10:26853472-26853494 GCATTTACAAAGTTTTGATTGGG - Intronic
1067809156 10:49413577-49413599 ACCTCTTCTATGTTTAGATACGG + Intergenic
1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG + Intronic
1069336894 10:67362521-67362543 GCATCTATTAAGATGATATATGG - Intronic
1070998600 10:80809023-80809045 TCATCAACTAAGTGAAGATAGGG - Intergenic
1074330179 10:112499109-112499131 GCATTTAATAAGTATATATAAGG + Intronic
1088787041 11:113191335-113191357 GGATATACTAAGTTTAAACAGGG - Intronic
1090157124 11:124451059-124451081 TCTTCTACTAATTTTAGATTTGG - Intergenic
1096051089 12:48608163-48608185 GCATCAATTCACTTTAGATAAGG + Intergenic
1098113591 12:67150692-67150714 GTATCCACTAAATTTAAATAGGG - Intergenic
1099859165 12:88206685-88206707 GCTTCTAATAAGCTCAGATAAGG - Intergenic
1102896527 12:116602775-116602797 GGATCTACTAATTGTAGCTAAGG + Intergenic
1105035136 12:132913874-132913896 TCATCTATTAAGTTTGAATATGG + Intronic
1105898357 13:24737016-24737038 TGACCTACGAAGTTTAGATATGG - Intergenic
1110929801 13:81200448-81200470 GACTATACTAATTTTAGATATGG - Intergenic
1113212227 13:107996862-107996884 TCTTCTACTAACTTTAGATTTGG + Intergenic
1114657555 14:24325196-24325218 GGATCTACAAGGTTAAGATAAGG + Intronic
1121849086 14:97202910-97202932 GCATCTACTATGTTCAGTCAAGG - Intergenic
1124908577 15:33895822-33895844 CCCTCCACTAATTTTAGATAAGG + Intronic
1134905745 16:17978224-17978246 GCTTCTCCTAAGTATAGATCTGG + Intergenic
1135255167 16:20935929-20935951 GCAGCTGCTCAGTTTAGACAAGG - Intronic
1137338752 16:47577028-47577050 GCATCAGCTAAGTTAAGAAAAGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1157568178 18:48694219-48694241 ACATCTACTAGGTTTTGATATGG - Intronic
1159536639 18:69723543-69723565 GCATTTTCTATGTTTAGAGATGG - Intronic
1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG + Intronic
1160319726 18:77878977-77878999 CCATCTACCAAGTATAGACATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927364803 2:22282022-22282044 GAAACTACGATGTTTAGATATGG + Intergenic
928826062 2:35422532-35422554 GTTTCTACAAAGTTTACATAGGG - Intergenic
929269140 2:39953772-39953794 GCATATACTAGGTTTATAAAAGG + Intergenic
932557519 2:72838287-72838309 CCACCTAGTAAGTTTTGATAAGG + Intergenic
938133110 2:128734044-128734066 GCAGCTACTATGTTAAGCTATGG - Intergenic
940619035 2:156087489-156087511 GCATATTGTAGGTTTAGATATGG + Intergenic
942809816 2:179984974-179984996 GTATCTACTATGTTCAGACATGG + Intronic
943600202 2:189908529-189908551 GCATCGAATAAGTTTTGACATGG + Intronic
945036409 2:205707574-205707596 GCATCTTCCAAGTTTTGTTAGGG + Intronic
1170171692 20:13420878-13420900 AAATCTACTCAGTATAGATAAGG + Intronic
1170560385 20:17552160-17552182 GCATCTGGTAATTTTAGACAGGG + Intronic
950865552 3:16185924-16185946 AAATCTACTAAGTTTTGATAAGG - Intronic
954774757 3:53006705-53006727 GCATCTATGAATTTTGGATATGG + Intronic
954803413 3:53200842-53200864 GCATCTACTAAGGGCAGATCTGG + Intergenic
956977721 3:74601153-74601175 GCATCTAATGAGTTTTGCTAAGG + Intergenic
959299779 3:104583424-104583446 GCAAATACTAAGTATGGATATGG + Intergenic
962296117 3:134189138-134189160 TCATATACTTAGTTTAGATATGG - Intronic
962824246 3:139084908-139084930 GCATCTACTAGGTGTGGACATGG + Intronic
965023115 3:163260799-163260821 GTATCTTGTAAGGTTAGATAAGG - Intergenic
967597566 3:191345161-191345183 GCATCTTCTAAGAATAGACAAGG + Intronic
969437560 4:7197388-7197410 GCATCTCCTGAGTTTAGAAGTGG + Intronic
972804568 4:42515306-42515328 GCAGCTACTAAGAATAGATGTGG + Intronic
973103272 4:46297904-46297926 GCATCTCGTAAGTTTTGGTATGG + Intronic
973671617 4:53224611-53224633 GCATCTACTAAGGTTATTTGGGG - Intronic
979403361 4:120278898-120278920 GTATCTAAAAAGTTGAGATAAGG - Intergenic
979589905 4:122466135-122466157 TCATCGCCTAACTTTAGATATGG - Intergenic
985117790 4:186608149-186608171 GAATCCACAAAGCTTAGATATGG - Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG + Intronic
994436407 5:99739769-99739791 CCATCTGCCATGTTTAGATATGG - Intergenic
994962014 5:106617367-106617389 GCATCTTCTAAGTTGTGCTACGG - Intergenic
995372042 5:111429102-111429124 TCTTCTACTAAGTTTAGGTTTGG - Intronic
998373376 5:141675226-141675248 GAATCTACTCAGGTTAGTTAAGG - Intronic
998695577 5:144634865-144634887 TCTTCTACTAATTTTAGATTTGG - Intergenic
999070851 5:148742193-148742215 GCATCTATTGAGATTATATATGG - Intergenic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1003700006 6:8452922-8452944 GCATCTTCTTATTTTAGATTGGG + Intergenic
1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG + Intergenic
1005666209 6:28059081-28059103 TCATCATCTAAGTTTAGATAAGG + Intergenic
1007112567 6:39321392-39321414 CCATCTACAAAGTGGAGATAGGG + Intronic
1007220593 6:40275827-40275849 GCATGTACTAAGTCTGAATATGG - Intergenic
1008602070 6:53106245-53106267 GCATCTACTAGGTTTGAATTGGG - Intergenic
1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG + Intergenic
1010413657 6:75589202-75589224 ACATATACAAAGTTTAGAAAGGG + Intergenic
1013722502 6:113047618-113047640 GCTTCTACTAAATTTGAATAAGG + Intergenic
1015030987 6:128595753-128595775 GTAGCTACTAAATTTAGATTTGG + Intergenic
1015110059 6:129582528-129582550 GTATCTACTAAGTCAAGGTAGGG + Intronic
1018045659 6:159963978-159964000 TCATCTAATAAGCTTAGATTTGG - Intergenic
1020561571 7:9734172-9734194 GTATATATTAAGTTTAGATTGGG - Intergenic
1020729232 7:11860151-11860173 GCATCTATTATATTTATATACGG - Intergenic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1031568868 7:123333078-123333100 GCTTCTAATAATTTTAGATTTGG - Intergenic
1041057638 8:54003549-54003571 TCATCAACTGATTTTAGATAAGG + Intronic
1041224729 8:55687058-55687080 GAACCTACTGAGTCTAGATAAGG - Intergenic
1041582840 8:59482763-59482785 GCTTCTACTAATTTTAGGTTTGG + Intergenic
1048006503 8:130423824-130423846 GCATTTACTATGTTTACATTTGG + Intronic
1057474075 9:95384164-95384186 GCATCTCCCAAGTATAGAAAAGG - Intergenic
1058787682 9:108406261-108406283 GCATATTTTAAGTTAAGATAAGG - Intergenic
1061379066 9:130243517-130243539 GCTTCTATTAAGTTCAGATCCGG + Intergenic
1061548529 9:131318716-131318738 GCATGCATGAAGTTTAGATATGG - Intergenic
1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG + Intronic