ID: 1153022762

View in Genome Browser
Species Human (GRCh38)
Location 18:646383-646405
Sequence CATCTACTAAGTTTAGATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153022758_1153022762 26 Left 1153022758 18:646334-646356 CCTTTTTTTTTTTCTAGTTGTAT 0: 1
1: 0
2: 25
3: 368
4: 3540
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1153022759_1153022762 -4 Left 1153022759 18:646364-646386 CCAACCAATATCTTTTTAGCATC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1153022760_1153022762 -8 Left 1153022760 18:646368-646390 CCAATATCTTTTTAGCATCTACT 0: 1
1: 0
2: 1
3: 35
4: 362
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153022762 Original CRISPR CATCTACTAAGTTTAGATAC GGG Intronic
900961701 1:5926294-5926316 CAACTATTAAGTTTTGGTACCGG + Intronic
907715971 1:56926345-56926367 CAACTTCTAAGTTTAGTGACTGG - Intergenic
908803189 1:67901739-67901761 CATCTATTAAGTTTTGATTATGG + Intergenic
909066774 1:70944675-70944697 CATCCACTTATTTCAGATACAGG - Intronic
909291784 1:73892017-73892039 CATCTACAAAATTAAGAGACTGG - Intergenic
910225524 1:84932132-84932154 GATCTAACAAGTTTAGATCCTGG + Intronic
911929273 1:103881197-103881219 CATCTACTAAATGTAGAGTCAGG + Intergenic
915275610 1:154786028-154786050 CATCTATTAAGTTTCCATTCTGG + Intronic
921620189 1:217316945-217316967 CACATAGTAAGTTTAGTTACAGG + Intergenic
1064338007 10:14461006-14461028 CATCTGCTAAGTCTAGAAATCGG + Intronic
1065477388 10:26154930-26154952 CATTTACTATTGTTAGATACAGG + Intronic
1066258586 10:33706172-33706194 TCCCTACTCAGTTTAGATACTGG + Intergenic
1066261201 10:33731193-33731215 CATTTACTTATTTTAGAAACAGG - Intergenic
1068327327 10:55510571-55510593 CTTCTGCTAAGTATAGATTCAGG + Intronic
1074077002 10:110137650-110137672 CATCTACTTTGTTGGGATACTGG - Intergenic
1079205221 11:18409086-18409108 TATATTCTAAGATTAGATACTGG - Intergenic
1083471365 11:62886350-62886372 CATTCACTAGCTTTAGATACAGG + Intronic
1085230319 11:74962166-74962188 CATCTTGAAATTTTAGATACTGG + Intronic
1087770742 11:102207072-102207094 AATCTACTAAGTTCAGATATTGG + Intronic
1088664770 11:112083597-112083619 CATATACTAAGTATAGCTATAGG - Exonic
1095814665 12:46408296-46408318 CATCTACTAAGTGGAGAAGCTGG + Intergenic
1096208320 12:49741941-49741963 CCTCTACTAAGTGTAGACGCAGG + Exonic
1105035137 12:132913875-132913897 CATCTATTAAGTTTGAATATGGG + Intronic
1105299355 13:19118515-19118537 CATATACTGAGGTTATATACAGG - Intergenic
1108685688 13:52817126-52817148 GATTTCCTAAGTTTAGAAACAGG - Intergenic
1110710378 13:78644411-78644433 GAACTAAAAAGTTTAGATACAGG - Intronic
1111886111 13:94023368-94023390 CATCTACTCAACTTAAATACTGG + Intronic
1116688006 14:48067381-48067403 CAGATACTGAGTTGAGATACAGG - Intergenic
1125239163 15:37553074-37553096 CATCTGCTAATTATAGGTACAGG + Intergenic
1131322854 15:91412266-91412288 CATTAACCAAGTTTAGAGACTGG + Intergenic
1131786612 15:95919821-95919843 TTTCTACAAAATTTAGATACAGG + Intergenic
1133803337 16:9102998-9103020 CATCAACGAAGTTTTGATATTGG + Exonic
1135719077 16:24799453-24799475 CATCTCCTCAGTTTAGAGAGAGG - Intronic
1139461404 16:67125537-67125559 TATCTGCTGAGTTTAGATCCTGG + Intronic
1140721172 16:77773585-77773607 CCTCTCCCAAGTTTGGATACAGG + Intergenic
1152998255 18:428569-428591 CAGCTGCTATGTTTAGGTACAGG + Intronic
1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG + Intronic
1157568177 18:48694218-48694240 CATCTACTAGGTTTTGATATGGG - Intronic
1159681887 18:71364205-71364227 CATATACAAAGTTTAAATATAGG - Intergenic
1162905795 19:13823146-13823168 CATTTACTTATTTTAGAGACAGG - Intronic
1165811785 19:38616183-38616205 CATCTACCAAGGTTAGAGAAAGG - Exonic
926391770 2:12401029-12401051 CAACAACTTAGTCTAGATACTGG + Intergenic
927840841 2:26442389-26442411 CATCTATTATGATTGGATACTGG + Intronic
929345390 2:40876894-40876916 AATGTACTAAGTTGAGCTACTGG - Intergenic
934123514 2:88863376-88863398 CATTTGCTAAGTAAAGATACTGG - Intergenic
935352558 2:102165959-102165981 CATATAGTAAGTTTTAATACTGG - Intronic
937581227 2:123490960-123490982 CCTCTACTAATTATATATACAGG + Intergenic
938001779 2:127747164-127747186 CATCTACACAATTTAGACACAGG + Intronic
1173598148 20:44273344-44273366 CAGGGACTAGGTTTAGATACTGG - Intronic
1179345214 21:40549857-40549879 CATTTTCTCAGCTTAGATACTGG - Intronic
954667776 3:52267346-52267368 CACATAATAATTTTAGATACTGG + Intronic
954835382 3:53462402-53462424 TATCTACTAACTTTAAAGACTGG + Intergenic
957478337 3:80756474-80756496 AATTTCCTAAGTTTAGATCCTGG + Intergenic
957667719 3:83255525-83255547 AATTTACTAAGTTTAGAAAAAGG - Intergenic
958492599 3:94796617-94796639 CATCAACTGAGTTAGGATACTGG - Intergenic
958597790 3:96251976-96251998 AATCTACTAAGTGTAGTTTCTGG - Intergenic
959594039 3:108109321-108109343 CATCTACTTTCTTTAGAAACTGG - Intergenic
964515804 3:157506344-157506366 CATCTACCAAGTATACAAACAGG + Intronic
969153916 4:5193351-5193373 CATCTACTAAGCTGAGGTACCGG - Intronic
969546533 4:7833475-7833497 CATCTACTATTTTTTGATTCTGG - Intronic
970394186 4:15649253-15649275 AATTTACTAACTTTAGGTACCGG - Intronic
970912021 4:21287980-21288002 CATCTACTAAGTAAAGCTGCAGG + Intronic
972062777 4:34899299-34899321 CATCTACTAACATTTGATAAAGG + Intergenic
974873048 4:67667376-67667398 CATCTAATTATTTTAAATACAGG - Intronic
975703707 4:77090979-77091001 CATCTACTAATTGTATATATTGG - Intergenic
976839560 4:89415563-89415585 CATCCACTAATTTAAGAAACTGG - Intergenic
976897761 4:90131829-90131851 AAACAACTAAGTTTAGAGACAGG - Intronic
978305633 4:107325054-107325076 CAATTACTAAGTTTAGACATAGG - Intergenic
978846618 4:113280828-113280850 GCTCTACTAAGGTTAGGTACAGG - Intronic
978866691 4:113521254-113521276 CATCAAGTAAGTTTAAATCCAGG - Intronic
979589904 4:122466134-122466156 CATCGCCTAACTTTAGATATGGG - Intergenic
981247663 4:142558676-142558698 AATCTACTATGTGTAGAAACTGG + Intronic
982460179 4:155660180-155660202 CATCTTCTATTTTTAGACACTGG - Intergenic
983933174 4:173475328-173475350 CATCTACTACTTGTAGATAATGG - Intergenic
984459496 4:180015549-180015571 CAACTTCAAAGTTTAAATACCGG - Intergenic
987196126 5:15528194-15528216 AATCTACTAAGATTATCTACAGG + Intronic
988795275 5:34647740-34647762 CAGCTACTAAGTGGAGAAACTGG + Intergenic
989498884 5:42142333-42142355 CATCAAGTAGGTTGAGATACAGG - Intergenic
991118127 5:62978097-62978119 CATCTTCTAAGTTGAGAGAAAGG + Intergenic
994004875 5:94826245-94826267 CATTTACTAACTTTAGATTTGGG + Intronic
998679769 5:144453967-144453989 CATCTGCTAAGTTTACTGACTGG - Intronic
1000487168 5:161861582-161861604 CAGCTACTAAGTCTAGATATGGG - Intronic
1005666210 6:28059082-28059104 CATCATCTAAGTTTAGATAAGGG + Intergenic
1005725696 6:28645904-28645926 CAACTTCTAAGTTTATGTACTGG - Intergenic
1011048906 6:83120929-83120951 ACTCTACAAAGTTAAGATACAGG + Intronic
1013000503 6:106017539-106017561 AAGCAACTAAGTTTAGAAACAGG + Intergenic
1014087246 6:117361041-117361063 CAACTACTAAGAGTAGAAACTGG + Intronic
1020961116 7:14803111-14803133 CATTTACTTATTTTAGAGACAGG + Intronic
1030509136 7:110461658-110461680 TATCTACGAAATTTAGATAATGG + Intergenic
1032821280 7:135526601-135526623 CATCTTCTAAGTTTACCTTCAGG + Intergenic
1041761035 8:61366662-61366684 CATCTACTATGTATAGGTACTGG + Intronic
1042282489 8:67069268-67069290 AATCTAATCAGATTAGATACAGG + Intronic
1046798685 8:118399898-118399920 CACCTACTAACTATAGAGACAGG - Intronic
1049250419 8:141585613-141585635 CATCTACTATGTGTTGATCCAGG - Intergenic
1051870647 9:21734091-21734113 CATTTACTAAATCTAGAAACTGG + Intergenic
1057693268 9:97306077-97306099 CACCTCCTGTGTTTAGATACGGG - Intergenic
1057827949 9:98385427-98385449 CACCTACAAAGTTAAGATAATGG - Intronic
1186861597 X:13678063-13678085 CATTTATTAAGGTTAGATGCAGG - Intronic