ID: 1153027890

View in Genome Browser
Species Human (GRCh38)
Location 18:687809-687831
Sequence GGTCCCAGTTCCCAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153027890_1153027895 6 Left 1153027890 18:687809-687831 CCTGGCTCTTGGGAACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 224
Right 1153027895 18:687838-687860 TGGAAATTACATGGAAGCAAAGG 0: 1
1: 0
2: 2
3: 21
4: 342
1153027890_1153027893 -3 Left 1153027890 18:687809-687831 CCTGGCTCTTGGGAACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 224
Right 1153027893 18:687829-687851 ACCTCTGGCTGGAAATTACATGG 0: 1
1: 0
2: 0
3: 11
4: 163
1153027890_1153027896 7 Left 1153027890 18:687809-687831 CCTGGCTCTTGGGAACTGGGACC 0: 1
1: 0
2: 0
3: 27
4: 224
Right 1153027896 18:687839-687861 GGAAATTACATGGAAGCAAAGGG 0: 1
1: 0
2: 3
3: 22
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153027890 Original CRISPR GGTCCCAGTTCCCAAGAGCC AGG (reversed) Intronic