ID: 1153029156

View in Genome Browser
Species Human (GRCh38)
Location 18:697521-697543
Sequence CAGGAGGACCACTTGAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39750
Summary {0: 1, 1: 6, 2: 248, 3: 4500, 4: 34995}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153029147_1153029156 27 Left 1153029147 18:697471-697493 CCAGGCGCGGTGGCTCATGCCTG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
Right 1153029156 18:697521-697543 CAGGAGGACCACTTGAGATGAGG 0: 1
1: 6
2: 248
3: 4500
4: 34995
1153029150_1153029156 8 Left 1153029150 18:697490-697512 CCTGTAATCTCAACACTTTGGGA 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
Right 1153029156 18:697521-697543 CAGGAGGACCACTTGAGATGAGG 0: 1
1: 6
2: 248
3: 4500
4: 34995

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153029156 Original CRISPR CAGGAGGACCACTTGAGATG AGG Intronic
Too many off-targets to display for this crispr