ID: 1153039685

View in Genome Browser
Species Human (GRCh38)
Location 18:800575-800597
Sequence GGTACATTCTTAGATACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153039678_1153039685 18 Left 1153039678 18:800534-800556 CCGCTAGAAAACAATGTTCCAGC 0: 1
1: 0
2: 2
3: 6
4: 150
Right 1153039685 18:800575-800597 GGTACATTCTTAGATACAATTGG 0: 1
1: 0
2: 2
3: 15
4: 290
1153039682_1153039685 0 Left 1153039682 18:800552-800574 CCAGCTTATTAGGGAGGACAAAG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1153039685 18:800575-800597 GGTACATTCTTAGATACAATTGG 0: 1
1: 0
2: 2
3: 15
4: 290
1153039677_1153039685 19 Left 1153039677 18:800533-800555 CCCGCTAGAAAACAATGTTCCAG 0: 1
1: 0
2: 2
3: 13
4: 178
Right 1153039685 18:800575-800597 GGTACATTCTTAGATACAATTGG 0: 1
1: 0
2: 2
3: 15
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153039685 Original CRISPR GGTACATTCTTAGATACAAT TGG Intronic
901885797 1:12222193-12222215 AGTTACTTCTTAGATACAATGGG + Intergenic
902242832 1:15100225-15100247 GGTACATGCTGCCATACAATGGG - Intronic
904057304 1:27679933-27679955 GGTTAATTCCTAGATACAATGGG + Intergenic
905063778 1:35162276-35162298 GTCACATTCTGAGATACACTAGG + Intergenic
908047256 1:60184327-60184349 AGTTACTTCTTAGATACAATGGG + Intergenic
909376859 1:74950928-74950950 GGTTACTTCCTAGATACAATGGG - Intergenic
909825927 1:80127190-80127212 AGTAACTTCCTAGATACAATGGG + Intergenic
909968753 1:81953439-81953461 GGTATACTCTTAAATAAAATAGG + Intronic
910642628 1:89480393-89480415 AGTTACTTCTTAGATACAATGGG + Intergenic
910715626 1:90226136-90226158 GGTTACTTCCTAGATACAATGGG - Intergenic
911736648 1:101343695-101343717 GGTACATTCTAAGGTACTAGGGG - Intergenic
911848351 1:102783377-102783399 AGTTAATTCCTAGATACAATGGG + Intergenic
911985389 1:104616293-104616315 GGTTACTTCCTAGATACAATGGG + Intergenic
913081759 1:115394973-115394995 AGTTACTTCTTAGATACAATAGG + Intergenic
913242158 1:116838493-116838515 AGTTACTTCTTAGATACAATTGG - Intergenic
913396278 1:118375987-118376009 GGTTACTTCCTAGATACAATAGG + Intergenic
914078284 1:144378324-144378346 GGTACATTTTGTGATACAAGAGG + Intergenic
914100895 1:144588177-144588199 GGTACATTTTGTGATACAAGAGG - Intergenic
914173192 1:145246858-145246880 GGTACATTTTGTGATACAAGAGG + Intergenic
914298085 1:146349460-146349482 GGTACATTTTGTGATACAAGAGG + Intergenic
914527847 1:148487994-148488016 GGTACATTTTGTGATACAAGAGG + Intergenic
914638542 1:149579068-149579090 GGTACATTTTGTGATACAAGAGG - Intergenic
915385584 1:155488993-155489015 TGTACATTCTTTTATACAAATGG + Intronic
916987611 1:170208158-170208180 AGTTGCTTCTTAGATACAATGGG - Intergenic
917040184 1:170797135-170797157 GCTACATTCTGAGATACTACTGG - Intergenic
918707828 1:187690135-187690157 AGTACATTAATAGATACAACTGG + Intergenic
918711451 1:187736434-187736456 AGTTATTTCTTAGATACAATGGG + Intergenic
918886143 1:190197477-190197499 AGTTACTTCTTAGATACAATGGG + Intronic
919091375 1:192982063-192982085 TGTACCTTCTAAGATACTATAGG - Intergenic
920860222 1:209699779-209699801 AGTTACTTCTTAGATACAATAGG + Intronic
924806690 1:247366979-247367001 GGTTACTTCCTAGATACAATGGG - Intergenic
1066407370 10:35130833-35130855 GATACATTCTTAGAAATATTAGG - Intronic
1066710257 10:38225894-38225916 GGTACATTGTTAAAAACCATGGG + Intergenic
1067977335 10:51041313-51041335 GGTACCAGCTCAGATACAATGGG - Intronic
1069805276 10:71118512-71118534 AGTTACTTCTTAGATACAATGGG - Intergenic
1070096394 10:73341550-73341572 GTTCCATTCTTAAATAAAATGGG + Exonic
1070673649 10:78397122-78397144 GGTACAATGTCAGATTCAATGGG + Intergenic
1071243751 10:83740430-83740452 AGTTACTTCTTAGATACAATGGG + Intergenic
1071818195 10:89253758-89253780 AGTTGCTTCTTAGATACAATGGG + Intronic
1071942109 10:90601475-90601497 GGTTATTTCCTAGATACAATGGG - Intergenic
1074647216 10:115471458-115471480 GGGAAATTCTTACACACAATTGG - Intronic
1075620360 10:123923133-123923155 GGGACATTCTAAAAGACAATTGG + Intronic
1078482307 11:11688058-11688080 AGTAACTTCCTAGATACAATGGG - Intergenic
1078623812 11:12935018-12935040 GGTACATACTTAGGTACCAGGGG + Intronic
1078945749 11:16067051-16067073 AGTTAATTCCTAGATACAATGGG - Intronic
1079147510 11:17867238-17867260 AGTTGCTTCTTAGATACAATGGG + Intronic
1079744488 11:24107420-24107442 AGTTACTTCTTAGATACAATGGG - Intergenic
1081403037 11:42664805-42664827 GGTGGATTCTTAGACAAAATTGG - Intergenic
1083165209 11:60880696-60880718 GGTACATTTTTAGACACTTTGGG + Intergenic
1083506377 11:63161220-63161242 GGTTACTTCCTAGATACAATGGG - Intronic
1086071485 11:82804340-82804362 GTTACTTGCTTAGATATAATAGG + Intergenic
1086253863 11:84850515-84850537 AGTACATTGTTGGATACAAGTGG - Intronic
1086886531 11:92212306-92212328 AGTACATACATAGATACAAAAGG - Intergenic
1087690585 11:101316999-101317021 AGTAACTTCCTAGATACAATGGG + Intergenic
1088505689 11:110525041-110525063 GGGACATTCTAAGAGACCATTGG - Intergenic
1089785168 11:120902487-120902509 GGGACAATCAAAGATACAATGGG + Intronic
1092652313 12:10647465-10647487 AGTTATTTCTTAGATACAATGGG - Intronic
1097587300 12:61530173-61530195 AGTTACTTCTTAGATACAATGGG + Intergenic
1097618150 12:61907980-61908002 GGTTACTTCCTAGATACAATGGG - Intronic
1098628269 12:72699337-72699359 GGTAGCTTCTTAGATACAATGGG + Intergenic
1098830771 12:75360396-75360418 AGTTCCTTCCTAGATACAATGGG + Intronic
1099151884 12:79124656-79124678 GATACATTCTTAGATTCTTTGGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099286954 12:80725004-80725026 GGTACATTCAGAGACAGAATAGG + Intergenic
1099635290 12:85204733-85204755 GGTTATTTCCTAGATACAATGGG - Intronic
1100205583 12:92345602-92345624 GGTTACTTCCTAGATACAATGGG - Intergenic
1102523283 12:113492709-113492731 AGTTAATTCCTAGATACAATGGG - Intergenic
1102939527 12:116927169-116927191 GGTACATACATACATACACTTGG + Intronic
1106718874 13:32418898-32418920 GGTTACTTCCTAGATACAATGGG - Intronic
1109721165 13:66277836-66277858 AGTTATTTCTTAGATACAATGGG - Intergenic
1109875960 13:68404975-68404997 AGTTATTTCTTAGATACAATGGG + Intergenic
1110543229 13:76728541-76728563 AGTAACTCCTTAGATACAATAGG - Intergenic
1110970454 13:81754520-81754542 GTTAACTTCTTAGATACAGTGGG - Intergenic
1111490685 13:88970514-88970536 GTGACATTCATAGATAAAATAGG - Intergenic
1111493020 13:89009405-89009427 GGCACATTCTTAATTAAAATAGG + Intergenic
1111798994 13:92959671-92959693 AGTTACTTCTTAGATACAATGGG + Intergenic
1112097620 13:96151989-96152011 GTTACATTCTGAGATACTAGGGG + Intronic
1112799236 13:103092460-103092482 AGTTACTTCTTAGATACAATGGG + Intergenic
1113133011 13:107059591-107059613 CGTTACTTCTTAGATACAATGGG + Intergenic
1113341685 13:109432268-109432290 AGTTACTTCTTAGATACAATGGG + Intergenic
1114301406 14:21382217-21382239 GGTACATTTTTACATAGATTTGG + Intronic
1114917696 14:27288505-27288527 AGTTACTTCTTAGATACAATGGG + Intergenic
1114987604 14:28250442-28250464 AGTTCCTTCCTAGATACAATGGG + Intergenic
1115942309 14:38622789-38622811 AGTTAGTTCTTAGATACAATGGG - Intergenic
1115989922 14:39141123-39141145 AGTTACTTCTTAGATACAATGGG + Intergenic
1116784217 14:49269535-49269557 GTAAAATCCTTAGATACAATGGG - Intergenic
1118239701 14:64044359-64044381 AGTTACTTCTTAGATACAATGGG - Intronic
1118472947 14:66092496-66092518 GGTTCATTCTTAAATACAATTGG + Intergenic
1119934092 14:78574654-78574676 AGTTACTTCTTAGATACAATGGG - Intronic
1124163665 15:27298591-27298613 GGTACTTGCTTAGAAACAAACGG + Intronic
1127051112 15:55085108-55085130 GGTTACTTCCTAGATACAATGGG - Intergenic
1131940643 15:97561310-97561332 TGTACATACTTACATACTATGGG - Intergenic
1135083895 16:19459265-19459287 GGTAGATTCCTAAACACAATTGG + Intronic
1135229872 16:20696550-20696572 TGTACAGTTTTAGATACTATTGG + Intronic
1135893559 16:26378489-26378511 GGTACATTCAAAGATCCAACAGG + Intergenic
1137818476 16:51421763-51421785 GGTTAATTCCTAGATAAAATGGG + Intergenic
1137991949 16:53166473-53166495 GGTACATTCCCAGATACCTTAGG + Intronic
1138721601 16:59088721-59088743 GTTACATTCTGAGATACTATGGG - Intergenic
1138859887 16:60743760-60743782 GATACATTCCCAGATACAATGGG + Intergenic
1139133951 16:64178879-64178901 AGTTACTTCTTAGATACAATGGG - Intergenic
1151157824 17:72139003-72139025 GGTCAAATCTAAGATACAATTGG - Intergenic
1153039685 18:800575-800597 GGTACATTCTTAGATACAATTGG + Intronic
1153151406 18:2098388-2098410 GGTAGATTGTTAGGTAAAATGGG - Intergenic
1153454931 18:5270806-5270828 AGTTACTTCTTAGATACAATGGG + Intergenic
1154982805 18:21517757-21517779 GGTACACTGTGAGATCCAATCGG - Intronic
1157842985 18:50976833-50976855 AGTTACTTCTTAGATACAATGGG + Intronic
1158822724 18:61179498-61179520 GGTTACTTCCTAGATACAATGGG - Intergenic
1158889527 18:61859915-61859937 GCTACATTCTGAGATACTAGGGG - Intronic
1159481608 18:68996671-68996693 AGTAACTTCCTAGATACAATGGG - Intronic
1159805758 18:72956998-72957020 AGTTAATTTTTAGATACAATGGG + Intergenic
931003151 2:57813425-57813447 GGTACATTGTTGGATAGAAGTGG - Intergenic
931814493 2:65887508-65887530 GCTACAGTCTTAGAGACAAGTGG - Intergenic
932182827 2:69664555-69664577 GTTACATTCTTGCATAGAATAGG + Intronic
932484455 2:72074906-72074928 GAGACATTCTTAGATATACTAGG - Intergenic
932904314 2:75733359-75733381 GGTTGCTTCCTAGATACAATGGG + Intergenic
933397806 2:81754321-81754343 AGTTACTTCTTAGATACAATGGG + Intergenic
935177180 2:100659644-100659666 TATACATTGTTAGATTCAATTGG + Intergenic
937620644 2:123980920-123980942 AGTTACTTCTTAGATACAATGGG - Intergenic
940269239 2:151873591-151873613 GGTACAATTTTAAATACAATTGG + Intronic
940430793 2:153587888-153587910 AGTAACTTCGTAGATACAATGGG + Intergenic
940578714 2:155549475-155549497 AGTTAATTCCTAGATACAATGGG + Intergenic
940790684 2:158027268-158027290 GGTTACTTCCTAGATACAATGGG + Intronic
940797015 2:158090542-158090564 TGTATATACTTAGATACATTTGG - Intronic
940893569 2:159058490-159058512 GGTACATTGCTAGATGCCATGGG + Intronic
942649706 2:178154164-178154186 AGTTAATTCCTAGATACAATAGG + Intergenic
942688033 2:178554707-178554729 GTTACAGTCTTAAATTCAATTGG + Exonic
942813018 2:180019817-180019839 GGTACATTCTTTGTGACATTAGG + Intergenic
944272114 2:197795859-197795881 AGTTACTTCTTAGATACAATGGG + Intergenic
944800262 2:203231742-203231764 AGTTACTTCTTAGATACAATGGG - Intergenic
944914970 2:204350307-204350329 GGTACAATCTTAAATATAAGTGG + Intergenic
945124192 2:206490000-206490022 GTTACATTCTTAGGTACTAGGGG - Intronic
945484850 2:210382626-210382648 AGTTACTTCTTAGATACAATGGG - Intergenic
945637236 2:212370528-212370550 GATACATTCTTAGCTACTTTGGG + Intronic
946384208 2:219372207-219372229 GGTACATTCTGTTATACAAAAGG + Intergenic
947396784 2:229694719-229694741 AGTTACTTCTTAGATACAATGGG - Intronic
1169609767 20:7365304-7365326 GGTTACTTCCTAGATACAATGGG - Intergenic
1173382087 20:42554716-42554738 GGTACATTTTTAGTTTCAATTGG + Intronic
1173634933 20:44547079-44547101 TGTACATCCTAACATACAATGGG + Intronic
1173913807 20:46691103-46691125 GGTACATTTATATACACAATGGG - Intergenic
1177271178 21:18850898-18850920 GGTTACTTCCTAGATACAATGGG - Intergenic
1177662619 21:24105727-24105749 GATAAATCCTGAGATACAATGGG + Intergenic
1177981142 21:27916014-27916036 AGTTACTTCTTAGATACAATGGG - Intergenic
1178021780 21:28416579-28416601 AGGACATTGTTAGATACAGTGGG - Intergenic
1181445331 22:22968350-22968372 AGTTAATTCTTAGATACAATGGG + Intergenic
1184300591 22:43556439-43556461 GGTATATTCTGAGATATACTGGG + Intronic
949435847 3:4028444-4028466 TGTCCATTCTTGGTTACAATAGG + Intronic
950985129 3:17355324-17355346 TGTTCATTCTTAAAAACAATTGG - Intronic
952029196 3:29120422-29120444 AGTTAATTCCTAGATACAATGGG - Intergenic
952170182 3:30798777-30798799 AGTAACTTCCTAGATACAATGGG + Intronic
956246189 3:67186146-67186168 AGTTACTTCTTAGATACAATGGG + Intergenic
956546283 3:70407420-70407442 GGTTACTTCCTAGATACAATGGG + Intergenic
957630431 3:82710703-82710725 AGTTACTTCTTAGATACAATGGG + Intergenic
957857364 3:85895423-85895445 AGTTACTTCTTAGATACAATGGG - Intronic
957929843 3:86863557-86863579 GGTAACTTCCTAGATACAATTGG - Intergenic
957981816 3:87520181-87520203 AGTTACTTCTTAGATACAATGGG - Intergenic
958831855 3:99099294-99099316 AGTTACTTCTTAGATACAATAGG - Intergenic
959305984 3:104666466-104666488 AGTTAATTCCTAGATACAATGGG - Intergenic
959348833 3:105234191-105234213 TGTACATTCTTAGACAAAATTGG + Intergenic
960858100 3:122123457-122123479 AGTAACTTCCTAGATACAATGGG - Intergenic
960918620 3:122723422-122723444 GATACATTCTACAATACAATTGG - Intronic
963497693 3:146088244-146088266 GGTACTTTCTTCTATAGAATTGG - Intronic
963538855 3:146561886-146561908 AGTTACTTCTTAGATACAATGGG + Intergenic
964885749 3:161480140-161480162 AGTACATTTTTAGAGACAGTAGG + Intergenic
964895441 3:161590253-161590275 AGTTCCTTCCTAGATACAATGGG + Intergenic
964978501 3:162648195-162648217 AGTTCCTTCCTAGATACAATGGG - Intergenic
966123307 3:176547499-176547521 AGTTATTTCTTAGATACAATGGG + Intergenic
967462203 3:189760331-189760353 AGTTCCTTCCTAGATACAATGGG + Intronic
970312532 4:14797792-14797814 AGTTAATTCCTAGATACAATGGG - Intergenic
970987546 4:22176233-22176255 AGTTACTTCTTAGATACAATGGG + Intergenic
971072028 4:23105138-23105160 AGTTACTTCTTAGATACAATGGG - Intergenic
971126442 4:23760412-23760434 AGTTACTTCTTAGATACAATGGG + Intronic
971561444 4:28083907-28083929 GGTTACTTATTAGATACAATGGG + Intergenic
971566526 4:28149956-28149978 GTTTCATTCTCAGATATAATGGG + Intergenic
971651065 4:29274724-29274746 GCTACATTTTTAGATAGAAGTGG - Intergenic
971681408 4:29706150-29706172 GGTTACTTCCTAGATACAATGGG + Intergenic
972582524 4:40407253-40407275 AGTTATTTCTTAGATACAATGGG - Intergenic
973063784 4:45762987-45763009 TGTTACTTCTTAGATACAATGGG + Intergenic
974475536 4:62374415-62374437 TATACATACTTAGATACAGTAGG - Intergenic
974864164 4:67560347-67560369 GGTACATTCTAGGATTCAGTAGG + Intronic
974944406 4:68509654-68509676 TGTACATTATTTGAGACAATGGG - Intergenic
975239790 4:72043698-72043720 GGTTACTTCCTAGATACAATGGG - Intronic
975361219 4:73474557-73474579 AGTTACTTCTTAGATACAATGGG + Intergenic
976715730 4:88120681-88120703 AGTAACTTCCTAGATACAATAGG - Intronic
978151837 4:105445412-105445434 GATACATTCTTGGTTAAAATGGG - Intronic
978153520 4:105464350-105464372 AGTTACTTCTTAGATACAATGGG - Intronic
978915621 4:114123520-114123542 AGTTAATTCCTAGATACAATGGG + Intergenic
979327784 4:119399647-119399669 AGTTACTTCTTAGATACAATTGG + Intergenic
979367928 4:119847793-119847815 AGTTACTTCTTAGATACAATGGG + Intergenic
979922919 4:126524215-126524237 AGTTATTTCTTAGATACAATAGG + Intergenic
980308963 4:131101611-131101633 GGCTACTTCTTAGATACAATGGG - Intergenic
980426248 4:132631007-132631029 GTTACTTTTTTAGATACAATGGG - Intergenic
980632756 4:135457539-135457561 GGTACATTCTCAGATACTACAGG + Intergenic
983236621 4:165187589-165187611 AGTTAATTCCTAGATACAATGGG + Intronic
983245534 4:165283369-165283391 AGTTACTTCTTAGATACAATGGG + Intronic
985220400 4:187697532-187697554 GGTTACTTCCTAGATACAATGGG - Intergenic
985220409 4:187697580-187697602 GGTTACTTCCTAGATACAATGGG - Intergenic
987493705 5:18616017-18616039 AGTTACTTCTTAGATACAATGGG + Intergenic
987585091 5:19844001-19844023 AGTTCTTTCATAGATACAATGGG - Intronic
988196959 5:28016008-28016030 AGTTATTTCTTAGATACAATGGG - Intergenic
988379333 5:30480555-30480577 AGTTCCTTCTTAGATATAATGGG + Intergenic
989483539 5:41961632-41961654 GGTACTGACTTAGATACCATAGG - Intergenic
990076761 5:51855236-51855258 GTTACATTCTGAGATACTAAGGG - Intergenic
990553318 5:56905675-56905697 CATACATTCTTATATTCAATTGG + Intergenic
992628980 5:78662394-78662416 GATACATGCATAGATACAAATGG + Intronic
993561757 5:89418401-89418423 GGTTACTTCCTAGATACAATGGG - Intergenic
993967089 5:94371917-94371939 GGTTACTTCCTAGATACAATGGG + Intronic
994019066 5:95002666-95002688 AGTTAATTCTTAGATACAATGGG - Intronic
994218673 5:97169113-97169135 GGTATATAGTTAGATACACTAGG + Intronic
994338871 5:98601475-98601497 AGTTAATTCCTAGATACAATGGG - Intergenic
994388463 5:99160994-99161016 GGAACATTCAAAGATAAAATTGG - Intergenic
995220459 5:109641869-109641891 AGTTATTTCTTAGATACAATGGG - Intergenic
995520613 5:113000887-113000909 GATACAGTATTAGAAACAATAGG + Intronic
995598114 5:113768348-113768370 AGTTTATTCCTAGATACAATGGG - Intergenic
995621688 5:114032521-114032543 GGTACTCTGATAGATACAATGGG + Intergenic
995698342 5:114905181-114905203 AGTTACTTCTTAGATACAATGGG + Intergenic
997274528 5:132573717-132573739 AGTTACTTCTTAGATACAATGGG + Intronic
998946021 5:147339855-147339877 AGTTACTTCTTAGATACAATGGG - Intronic
1000728386 5:164801085-164801107 AGTTCTTTCCTAGATACAATGGG + Intergenic
1000947295 5:167437391-167437413 AGTTACTTCTTAGATACAATGGG - Intronic
1002038337 5:176490703-176490725 TGTTCATTCTTAAATAAAATGGG - Intronic
1004071563 6:12302795-12302817 GGTAAATTATTTGACACAATGGG + Intergenic
1004322513 6:14643370-14643392 GGTACATTTTATCATACAATCGG - Intergenic
1008762588 6:54870802-54870824 GGTACTTTCCTAAAAACAATAGG - Intronic
1008930254 6:56931829-56931851 AGTTACTTCTTAGATACAATGGG - Intronic
1009793457 6:68434729-68434751 GATACTTTCTTAGAATCAATGGG + Intergenic
1010061326 6:71626010-71626032 GGTTACTTCTTAGATGCAATGGG - Intergenic
1011053663 6:83182617-83182639 AGTACATTCTGAGATACTTTGGG - Intronic
1012070145 6:94604182-94604204 AGTTAATTCATAGATACAATGGG + Intergenic
1012195521 6:96336250-96336272 AGTAATTTCCTAGATACAATGGG - Intergenic
1012281133 6:97329133-97329155 GGTGACTTCGTAGATACAATGGG - Intergenic
1012768374 6:103397674-103397696 AGTTACTTCTTAGATACAATGGG - Intergenic
1013721697 6:113038344-113038366 GTCACATTCTGAGATACTATGGG - Intergenic
1015021349 6:128479546-128479568 GGTACATTTTTAATTGCAATAGG + Intronic
1015608906 6:134992438-134992460 GCTATATTCTTTTATACAATTGG - Intronic
1015716693 6:136199970-136199992 GGGACATTCATTGTTACAATTGG - Intergenic
1016122838 6:140364703-140364725 GGTTAATTCCTAGATACAATGGG - Intergenic
1016138682 6:140581320-140581342 GGTAATTTCTTAGATAAATTTGG - Intergenic
1017659188 6:156657255-156657277 GTTCCATTCTTAGATCAAATGGG + Intergenic
1018302962 6:162423156-162423178 GTTACATTCCTAGATACTCTTGG + Intronic
1018866803 6:167752806-167752828 AGTTCCTTCCTAGATACAATAGG + Intergenic
1019050538 6:169179775-169179797 AGTTCCTTCCTAGATACAATTGG + Intergenic
1020768703 7:12359018-12359040 GAGACATTATTAGAGACAATAGG - Intronic
1021394537 7:20131141-20131163 GTTACATTCTTAGGTACCAGGGG - Intergenic
1022435204 7:30376821-30376843 TGTACATTCATAGATAGCATTGG + Intronic
1022862604 7:34383428-34383450 GGTTACTTCCTAGATACAATGGG - Intergenic
1026197685 7:68187046-68187068 GGTACATTTTTATATATCATAGG - Intergenic
1027991081 7:85361393-85361415 AGCAAATTCCTAGATACAATGGG - Intergenic
1028359918 7:89955510-89955532 AGTTAATTCCTAGATACAATGGG + Intergenic
1030553940 7:110999745-110999767 GGTCCATTCATAGTTACAAAAGG + Intronic
1031265463 7:119573927-119573949 TGTACATTCTTACTTACAAGTGG - Intergenic
1033871845 7:145763198-145763220 GGTTACTTCCTAGATACAATGGG - Intergenic
1034718277 7:153263902-153263924 AGTTAATTCCTAGATACAATGGG + Intergenic
1035964564 8:4176232-4176254 TGTACGTTCTTATATACATTTGG + Intronic
1036106398 8:5845594-5845616 GGTTGCTTCCTAGATACAATGGG + Intergenic
1036504320 8:9341627-9341649 GCCACATTCTGAGATACAATGGG - Intergenic
1037473338 8:19232316-19232338 GGAACAATTTCAGATACAATAGG - Intergenic
1037533794 8:19806296-19806318 GTTACATTCTGAGATACTATGGG + Intergenic
1038875361 8:31542709-31542731 GTAGCATTCTTATATACAATGGG - Intergenic
1040091192 8:43400687-43400709 AGTGATTTCTTAGATACAATGGG + Intergenic
1041035862 8:53789607-53789629 GATACATTCTTTGAAACAACAGG + Intronic
1041849949 8:62379227-62379249 AGTAACTTCCTAGATACAATCGG - Intronic
1043921806 8:85991526-85991548 GGCACATTCATAGATGTAATTGG - Intronic
1045139919 8:99268635-99268657 TGTAACTTCCTAGATACAATGGG - Intronic
1045375577 8:101570756-101570778 GGTACATCATTAGCCACAATAGG - Intronic
1045677583 8:104625145-104625167 ATTAAATTCTTATATACAATGGG - Intronic
1046703142 8:117423548-117423570 GGTTACTTCCTAGATACAATGGG + Intergenic
1047870036 8:129072059-129072081 AGTTCCTTCCTAGATACAATGGG - Intergenic
1048046180 8:130775388-130775410 AGTTAGTTCTTAGATACAATGGG - Intergenic
1048217508 8:132509944-132509966 GGTTACTTCCTAGATACAATAGG + Intergenic
1048557277 8:135491951-135491973 GGAACATTCTTAAGTAAAATTGG - Intronic
1048668271 8:136689025-136689047 AGTTACTTCTTAGATACAATGGG + Intergenic
1048923438 8:139250790-139250812 AGTTAATTCCTAGATACAATCGG - Intergenic
1049735145 8:144200970-144200992 GGGACATTCTACGAAACAATTGG - Intronic
1050685030 9:8158808-8158830 GGAATATGCTTAGATAAAATCGG + Intergenic
1051037808 9:12770162-12770184 GTTACATTCTGAGGTACCATAGG - Intergenic
1057424758 9:94939298-94939320 GGTCAATCCTTATATACAATGGG - Intronic
1058082138 9:100711940-100711962 AGTTCCTTCCTAGATACAATGGG + Intergenic
1185893721 X:3841300-3841322 AGTTACTTCTTAGATACAATGGG - Intronic
1185898836 X:3879724-3879746 AGTTACTTCTTAGATACAATGGG - Intergenic
1185903953 X:3918153-3918175 AGTTACTTCTTAGATACAATGGG - Intergenic
1187166207 X:16806427-16806449 GGTAAATTATTAGAAACAAAGGG + Intronic
1187906677 X:24073017-24073039 GGTAAATTCTTACTTACATTTGG + Intronic
1188124424 X:26350834-26350856 AGTTACTTCTTAGATACAATGGG + Intergenic
1188595283 X:31892882-31892904 GATACAATTTTAGATACACTGGG + Intronic
1188794123 X:34441544-34441566 AGTTACTTCTTAGATACAATGGG + Intergenic
1188959757 X:36476641-36476663 GGTACATTATTTAATATAATAGG + Intergenic
1189253644 X:39620754-39620776 AGTAACTTCCTAGATACAATGGG + Intergenic
1190498813 X:51055161-51055183 TGTACATTCATAGTTACAAGGGG + Intergenic
1191201728 X:57790435-57790457 GGTACAATCTTGAATAGAATGGG - Intergenic
1192003411 X:67181802-67181824 AGTTACTTCTTAGATACAATTGG - Intergenic
1192600249 X:72455300-72455322 GGGACATTCTTAGGTCAAATTGG - Intronic
1193797324 X:85892099-85892121 GTTAACTTCCTAGATACAATGGG - Intronic
1194297479 X:92144104-92144126 GGTTACTTCCTAGATACAATGGG - Intronic
1194860258 X:98990752-98990774 GGTTACTTCCTAGATACAATAGG + Intergenic
1195418888 X:104651577-104651599 GGTACAATCATAGATAGAATAGG + Intronic
1196930327 X:120675590-120675612 AGTGACTTCTTAGATACAATGGG + Intergenic
1197443273 X:126515847-126515869 GTTATATTTTTAAATACAATTGG - Intergenic
1198612603 X:138418463-138418485 AGTTACTTCTTAGATACAATGGG - Intergenic
1199053237 X:143262134-143262156 CCTTCATTCTTAGATAAAATGGG - Intergenic
1199619504 X:149686579-149686601 AGTTACTTCTTAGATACAATGGG - Intergenic
1200295272 X:154913539-154913561 AGTTCCTTCCTAGATACAATAGG + Intronic
1200445405 Y:3255726-3255748 AGTAACTTCCTAGATACAATGGG + Intergenic
1200615050 Y:5369005-5369027 GGTTACTTCCTAGATACAATGGG - Intronic
1201538793 Y:15083796-15083818 GGTTTATTCTTAATTACAATTGG + Intergenic
1201916233 Y:19184375-19184397 AGTACATTCTTACTTACAAGTGG + Intergenic
1202259656 Y:22957217-22957239 GTGACATTTTTACATACAATTGG + Intergenic
1202412642 Y:24590961-24590983 GTGACATTTTTACATACAATTGG + Intergenic
1202458138 Y:25079109-25079131 GTGACATTTTTACATACAATTGG - Intergenic