ID: 1153040037

View in Genome Browser
Species Human (GRCh38)
Location 18:803823-803845
Sequence ACTGATTATCAGTTTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153040037_1153040040 23 Left 1153040037 18:803823-803845 CCAGGCAAAAACTGATAATCAGT 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1153040040 18:803869-803891 TATTATTTTACCTATTTGTGAGG 0: 1
1: 0
2: 10
3: 144
4: 927

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153040037 Original CRISPR ACTGATTATCAGTTTTTGCC TGG (reversed) Intronic
902127804 1:14231656-14231678 ACTGATAACCAGTTATTGCTAGG - Intergenic
904515489 1:31051609-31051631 ACTGATTTTTTTTTTTTGCCTGG + Intronic
905589276 1:39147912-39147934 ACTGATCATCAGTTTTTAAGAGG - Intronic
907752005 1:57271691-57271713 CCTGATTATCTGTGTTTGGCTGG + Intronic
909273647 1:73656666-73656688 TCTGATTATCATTATTTACCAGG - Intergenic
912090080 1:106061738-106061760 GCTGATTTACAGTCTTTGCCTGG + Intergenic
912868258 1:113278774-113278796 ATTGATGATGAGTTTCTGCCTGG - Intergenic
916271726 1:162950245-162950267 ACTGATCACCAGTTCTTTCCTGG - Intergenic
918394395 1:184098926-184098948 ACTAATTATCTACTTTTGCCGGG + Intergenic
918537797 1:185593738-185593760 ACTCATTATCTATTTTTGCATGG - Intergenic
919232397 1:194790952-194790974 ATTTATTATCAGTTTTTGTAAGG - Intergenic
920251220 1:204623638-204623660 GCTGATTAGCAGTTTCTACCGGG + Intronic
924091059 1:240501351-240501373 ACTGACTATCATTTTGTTCCAGG + Intronic
924137003 1:240978181-240978203 ACTGATCTTCAGTTATTGACAGG - Intronic
924655098 1:245967418-245967440 ACTGATCATAGGTTTGTGCCTGG - Intronic
1065421151 10:25545817-25545839 ACTGATTATCTCCTATTGCCAGG + Intronic
1066097293 10:32084443-32084465 TCTGATGACCAGTTTTGGCCTGG + Intergenic
1072938807 10:99739815-99739837 ACTGATTATCAGTTGCTTCCAGG - Intronic
1075276857 10:121101679-121101701 ACTGATTATCAATATCTCCCTGG - Intergenic
1077731784 11:4738689-4738711 ACTGATTATAACTTATTCCCAGG - Intronic
1077905008 11:6525192-6525214 TCTGACTCTCACTTTTTGCCAGG + Intronic
1079035766 11:17018596-17018618 ACTGATTATTAGTGGTTGCCAGG + Intergenic
1079746916 11:24144451-24144473 ACTGATTAACAGTATTTGGCAGG + Intergenic
1079921830 11:26442416-26442438 ACTGGTTATAAGTTCTCGCCAGG - Intronic
1080177291 11:29380214-29380236 ATTGAGTATCAGTATTTGCAAGG - Intergenic
1086407928 11:86515176-86515198 ACTGAATATTAGCTTTTGCGGGG - Intronic
1088025298 11:105173259-105173281 ATTGATTATCATTTTTTAACTGG + Intergenic
1088797530 11:113276287-113276309 TCTGATCTGCAGTTTTTGCCTGG + Exonic
1089910581 11:122095978-122096000 ACTAATTAGCATTTATTGCCTGG + Intergenic
1095601272 12:44016026-44016048 ACAGATTAACAGTTTATTCCTGG - Intronic
1096438757 12:51619997-51620019 AGTGATAATCATTTTTTTCCTGG + Intronic
1098369876 12:69746576-69746598 ACTTAGTATCAGGATTTGCCCGG + Intronic
1102635405 12:114319400-114319422 TCTGACAATGAGTTTTTGCCTGG - Intergenic
1106337643 13:28798323-28798345 ACTGATTGTCAGTTTTCTACGGG - Intergenic
1116294044 14:43082009-43082031 AGTGATTGCCAGTTTCTGCCAGG - Intergenic
1118698756 14:68412077-68412099 AAGGATTTTCAGTTTTGGCCAGG - Intronic
1123430637 15:20212859-20212881 ACCGATTATCAGTTTTTGTGAGG - Intergenic
1126044637 15:44627447-44627469 ACTGATTTTCAACTTTTGCCAGG - Intronic
1136854002 16:33638358-33638380 ACTGATTATCAGTTTTTGTGAGG + Intergenic
1139841394 16:69883734-69883756 TCTGTTTAACAGTTTTTGCAGGG - Intronic
1141003555 16:80331026-80331048 ACTGCATATCAGTTTATGACTGG - Intergenic
1203115582 16_KI270728v1_random:1486797-1486819 ACCGATTATCAGTTTTTGTGAGG + Intergenic
1144296453 17:13879564-13879586 AATGATTATCAATATTTCCCAGG - Intergenic
1147417564 17:40304441-40304463 TGTGGTTAGCAGTTTTTGCCAGG + Exonic
1147837230 17:43342675-43342697 AGTGATTATCAGTTATACCCGGG + Intergenic
1153040037 18:803823-803845 ACTGATTATCAGTTTTTGCCTGG - Intronic
1153085527 18:1281637-1281659 ACTGATTATCAGTCTATTCAGGG - Intergenic
1156276869 18:35592214-35592236 ATTGAGTATCTGTTTGTGCCAGG + Intronic
1157934577 18:51858913-51858935 GCTGATTATCAGTATATGCATGG + Intergenic
1158453723 18:57588507-57588529 ACTAATCATCAGCGTTTGCCTGG - Intergenic
1163225666 19:15959401-15959423 ACTGAGAATCAGTGTTGGCCTGG - Intergenic
1164193820 19:22935742-22935764 AATGATTATCTTCTTTTGCCTGG + Intergenic
1164790502 19:30973579-30973601 ACTGATTCTCAGGTTTTGATTGG + Intergenic
1164863715 19:31585273-31585295 ACTGATTGGCAGTTTTATCCAGG + Intergenic
926281618 2:11452668-11452690 AATGAAAATCAGTTGTTGCCTGG - Intronic
928715739 2:34057825-34057847 ACTGGTTAGCAGCTTGTGCCTGG + Intergenic
930546769 2:52777629-52777651 ACTGGTTTTCAGTTTCTTCCTGG - Intergenic
932125243 2:69139377-69139399 ACTGATTCTCAGGGCTTGCCTGG - Intronic
933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG + Intronic
934971241 2:98766221-98766243 ACTGATCATCATTTTGAGCCAGG - Intergenic
935587305 2:104813170-104813192 GCTGGTGATCAGTTTTTGCCTGG - Intergenic
935868507 2:107418823-107418845 ACTGCTTATCAGTGAATGCCTGG + Intergenic
936165671 2:110117103-110117125 ACTGATCATCCCTTTTTCCCAGG + Intergenic
936863004 2:117040706-117040728 ACTCTTTATCAGTTTCTCCCAGG - Intergenic
936932218 2:117801787-117801809 ACTCATTAGCAGTTTTTGAGGGG - Intergenic
939927800 2:148195228-148195250 TCTGATTATTAGTGTTTGCATGG - Intronic
941269973 2:163413398-163413420 ACTGCTTATCAGTTTGGGCCCGG - Intergenic
943541069 2:189214892-189214914 TATTATTATCAGCTTTTGCCAGG + Intergenic
946942886 2:224788147-224788169 ACTGGGCATCTGTTTTTGCCTGG + Intronic
1169423222 20:5475837-5475859 CCTGATGATCAGTTTCTGCCTGG + Intergenic
1172608414 20:36231385-36231407 ACTGATTACCTGCTTGTGCCAGG + Exonic
1172613819 20:36270446-36270468 ACAAATGATCAGTTTTGGCCAGG - Intronic
1173242982 20:41314346-41314368 CCTGCTTATCAGTTTTTGGATGG - Intronic
1173245431 20:41334561-41334583 ACAGAATATCAGTTTATGCTGGG - Intergenic
1174889818 20:54379125-54379147 ACTCCTTATCACTTTTTTCCAGG + Intergenic
1179133312 21:38658446-38658468 ACTTGCTATCGGTTTTTGCCTGG + Intronic
1181657376 22:24314394-24314416 AATGATTATCAGTTATTTCAAGG - Intronic
1183776193 22:39967794-39967816 ACAGACTAACACTTTTTGCCTGG - Intronic
950221318 3:11198477-11198499 ATTGAATGTCTGTTTTTGCCTGG + Intronic
952439060 3:33305333-33305355 ATGGATTATCAATTTTTTCCAGG + Intronic
956783009 3:72619160-72619182 ACAGATTGTCAGATTGTGCCCGG - Intergenic
958565633 3:95806115-95806137 ACTGATTTTCATTATATGCCTGG - Intergenic
959988273 3:112600930-112600952 ACTGCTTTTAAATTTTTGCCAGG - Intergenic
961988493 3:131162268-131162290 AAAGCTTATTAGTTTTTGCCTGG + Intronic
963543235 3:146621973-146621995 TCTCATTATCAGTTTTTCCTAGG + Intergenic
967068820 3:185944157-185944179 ACTGATTCAGAATTTTTGCCAGG + Intergenic
972103678 4:35455152-35455174 ACATATTATCAGCTTTTGCCTGG - Intergenic
974982089 4:68969445-68969467 ACTGATTCTCCGTTTTTTTCCGG + Intergenic
975319716 4:72996158-72996180 ACTGATTATCAGTTCATACTTGG + Intergenic
975496494 4:75041206-75041228 TCTGATTATCATTTCCTGCCTGG - Intronic
981583828 4:146277874-146277896 AATGAGTATCAGTTTATGACTGG + Intronic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
983294193 4:165844992-165845014 ACTGATGATCGCTTTTAGCCAGG - Intergenic
983447609 4:167874521-167874543 ATTGATAATCAGTGTTTGGCGGG - Intergenic
983561521 4:169106565-169106587 AGTGATTGACAGTTTTTACCTGG + Intronic
984562085 4:181282575-181282597 GTTCATTATCAATTTTTGCCGGG - Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991491639 5:67189397-67189419 ACTCGTTATCAGTTTTTCACTGG - Intronic
992465904 5:77004107-77004129 ACTTATTATCAGTTTATTTCTGG - Intergenic
996041210 5:118813932-118813954 ATTGTTCATCAGTATTTGCCAGG - Intergenic
997555308 5:134792428-134792450 ACTGAATATCTGTTTCTTCCAGG + Intronic
999613119 5:153392495-153392517 TATTATTATCATTTTTTGCCAGG + Intergenic
1004741060 6:18461699-18461721 TCTCATTTTCAGTTTTAGCCAGG + Intronic
1010100636 6:72102956-72102978 AGTGATTATAAGAGTTTGCCTGG + Intronic
1012077599 6:94711915-94711937 ATTTATTATCAGTTTTTCCAAGG + Intergenic
1012860721 6:104556118-104556140 AATTATAATCAGTTTTTCCCAGG + Intergenic
1013645918 6:112141111-112141133 TCTGATTATTAGATTTTACCTGG - Intronic
1015075199 6:129148427-129148449 ACAGATGATCAGTGTTTCCCAGG + Intronic
1015356819 6:132287159-132287181 ATTGAATGTCAGTGTTTGCCAGG - Intergenic
1015461534 6:133497034-133497056 ACTGAGTATCATTTTTTTACTGG + Intronic
1016743902 6:147557847-147557869 ACTGATTAGCAGTTTGACCCTGG + Intronic
1017186866 6:151610444-151610466 ACTGATTACTATATTTTGCCTGG + Intronic
1020712825 7:11630216-11630238 ACAGCTTATCTCTTTTTGCCTGG - Intronic
1020977989 7:15031684-15031706 AGTCATTATCAATTCTTGCCTGG + Intergenic
1024830092 7:53442005-53442027 ACAGATCATCAGTTTTTCCTTGG + Intergenic
1026312413 7:69198070-69198092 ATTGATTTTCTGTTTTTTCCTGG - Intergenic
1028095068 7:86749876-86749898 TCTGATTCCCAGTTTTTGACTGG - Intronic
1030634706 7:111935760-111935782 ACTGACTGTCAGTTTTAGCATGG + Intronic
1032483051 7:132262143-132262165 ATTGATTTTCAGTTTTAGCCTGG - Intronic
1033177573 7:139139353-139139375 ACTTTTTATCAGTCTTTCCCAGG - Intronic
1033467106 7:141603457-141603479 GCTTATTTTTAGTTTTTGCCTGG + Intronic
1034496487 7:151426433-151426455 ACTGATAACCAGTCATTGCCAGG + Intergenic
1038353798 8:26807262-26807284 ACTGATTTTCAGATTTTCACAGG + Intronic
1038527268 8:28286700-28286722 ATTTATCATCAGTTTTTGGCTGG + Intergenic
1040694681 8:49981285-49981307 TCTGATTATGAGTCTTTCCCAGG - Intronic
1042250299 8:66749896-66749918 ACTGAGTATCAGCCTCTGCCTGG + Intronic
1042629454 8:70800838-70800860 ACTGATTATCAGTGTGTTCAGGG + Intergenic
1043302844 8:78755585-78755607 TCTGATTTACAATTTTTGCCAGG - Intronic
1043387192 8:79759980-79760002 GTTTATTATCTGTTTTTGCCTGG - Intergenic
1044301165 8:90584982-90585004 TCTTAGCATCAGTTTTTGCCTGG - Intergenic
1044645338 8:94436520-94436542 CCAGATTTCCAGTTTTTGCCTGG - Exonic
1045113537 8:98956211-98956233 TTTCACTATCAGTTTTTGCCTGG - Intergenic
1047924248 8:129667205-129667227 ACTGCTTATCATTTTTTCCATGG - Intergenic
1050107149 9:2177482-2177504 ACTAATTATCAATTTTCGCCTGG + Intronic
1053260397 9:36658592-36658614 ACTGATTTTCAGTCTTTGCTTGG + Intronic
1056041962 9:82677525-82677547 ACTGATTATTCATTTTTGCCTGG + Intergenic
1056831023 9:89917725-89917747 AGCAATTATCATTTTTTGCCTGG + Intergenic
1057531749 9:95853834-95853856 AATAATTATCATTATTTGCCTGG + Intergenic
1058803341 9:108566163-108566185 GCTGATTCTCAGTTTGGGCCTGG - Intergenic
1059953438 9:119491559-119491581 ATTGATTATCAATGTCTGCCTGG + Intergenic
1062345073 9:136110779-136110801 TCTGATTTTCAGTCTGTGCCTGG - Intergenic
1186115936 X:6305194-6305216 ACAGTTAACCAGTTTTTGCCAGG - Intergenic
1186425526 X:9462376-9462398 ACTTATTTTCAGTTATTGACTGG - Intergenic
1187800001 X:23051001-23051023 ACTGATTATTATTTTTTGCTTGG - Intergenic
1188161807 X:26814104-26814126 AGTGAATATCAGTTTTAGCCAGG - Intergenic
1190414103 X:50164381-50164403 ACTGATTTTTGGTGTTTGCCAGG - Intergenic
1194970724 X:100340340-100340362 ATTGATTCTCACTTTATGCCTGG - Intronic
1195092603 X:101475671-101475693 TCTTTTTATTAGTTTTTGCCTGG - Intronic
1195196305 X:102500664-102500686 ACTGATTTTTAGCTTTGGCCAGG - Intergenic