ID: 1153043593

View in Genome Browser
Species Human (GRCh38)
Location 18:836232-836254
Sequence CAGTTTTAGTAGAAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153043591_1153043593 -10 Left 1153043591 18:836219-836241 CCTTTAATAGGAGCAGTTTTAGT No data
Right 1153043593 18:836232-836254 CAGTTTTAGTAGAAGAATGAGGG No data
1153043589_1153043593 23 Left 1153043589 18:836186-836208 CCACTGGGTCTGGCAAACAAGGT No data
Right 1153043593 18:836232-836254 CAGTTTTAGTAGAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153043593 Original CRISPR CAGTTTTAGTAGAAGAATGA GGG Intergenic
No off target data available for this crispr