ID: 1153051089

View in Genome Browser
Species Human (GRCh38)
Location 18:904148-904170
Sequence TTCACCCGTTTCTCAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153051089_1153051091 1 Left 1153051089 18:904148-904170 CCTGTCCTTGAGAAACGGGTGAA No data
Right 1153051091 18:904172-904194 TTGAAAACCATCAAAACAATTGG No data
1153051089_1153051093 17 Left 1153051089 18:904148-904170 CCTGTCCTTGAGAAACGGGTGAA No data
Right 1153051093 18:904188-904210 CAATTGGACTTCTTAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153051089 Original CRISPR TTCACCCGTTTCTCAAGGAC AGG (reversed) Intergenic
No off target data available for this crispr