ID: 1153051091

View in Genome Browser
Species Human (GRCh38)
Location 18:904172-904194
Sequence TTGAAAACCATCAAAACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153051090_1153051091 -4 Left 1153051090 18:904153-904175 CCTTGAGAAACGGGTGAAATTGA No data
Right 1153051091 18:904172-904194 TTGAAAACCATCAAAACAATTGG No data
1153051086_1153051091 25 Left 1153051086 18:904124-904146 CCTCAAAATTCTAAAAATTCTTT No data
Right 1153051091 18:904172-904194 TTGAAAACCATCAAAACAATTGG No data
1153051089_1153051091 1 Left 1153051089 18:904148-904170 CCTGTCCTTGAGAAACGGGTGAA No data
Right 1153051091 18:904172-904194 TTGAAAACCATCAAAACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153051091 Original CRISPR TTGAAAACCATCAAAACAAT TGG Intergenic
No off target data available for this crispr