ID: 1153052151

View in Genome Browser
Species Human (GRCh38)
Location 18:909343-909365
Sequence CTCCCCGAAGGCTCCCGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153052138_1153052151 22 Left 1153052138 18:909298-909320 CCAGGCAGAGGCGGGCGACGCGG 0: 1
1: 1
2: 1
3: 18
4: 212
Right 1153052151 18:909343-909365 CTCCCCGAAGGCTCCCGCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153052151 Original CRISPR CTCCCCGAAGGCTCCCGCGT GGG Intronic