ID: 1153054182

View in Genome Browser
Species Human (GRCh38)
Location 18:929302-929324
Sequence CTGTGAAGAAGAGGTTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153054182_1153054188 3 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054188 18:929328-929350 TCATCAACAGAGTTGGGGACAGG No data
1153054182_1153054185 -4 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054185 18:929321-929343 ACAGGACTCATCAACAGAGTTGG No data
1153054182_1153054189 11 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054189 18:929336-929358 AGAGTTGGGGACAGGTTTTGTGG No data
1153054182_1153054190 12 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054190 18:929337-929359 GAGTTGGGGACAGGTTTTGTGGG No data
1153054182_1153054186 -3 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054186 18:929322-929344 CAGGACTCATCAACAGAGTTGGG No data
1153054182_1153054187 -2 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054187 18:929323-929345 AGGACTCATCAACAGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153054182 Original CRISPR CTGTGAAGAAGAGGTTTCCA CGG (reversed) Intergenic
No off target data available for this crispr