ID: 1153054186

View in Genome Browser
Species Human (GRCh38)
Location 18:929322-929344
Sequence CAGGACTCATCAACAGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153054181_1153054186 0 Left 1153054181 18:929299-929321 CCACCGTGGAAACCTCTTCTTCA No data
Right 1153054186 18:929322-929344 CAGGACTCATCAACAGAGTTGGG No data
1153054182_1153054186 -3 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054186 18:929322-929344 CAGGACTCATCAACAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153054186 Original CRISPR CAGGACTCATCAACAGAGTT GGG Intergenic
No off target data available for this crispr