ID: 1153054189

View in Genome Browser
Species Human (GRCh38)
Location 18:929336-929358
Sequence AGAGTTGGGGACAGGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153054181_1153054189 14 Left 1153054181 18:929299-929321 CCACCGTGGAAACCTCTTCTTCA No data
Right 1153054189 18:929336-929358 AGAGTTGGGGACAGGTTTTGTGG No data
1153054182_1153054189 11 Left 1153054182 18:929302-929324 CCGTGGAAACCTCTTCTTCACAG No data
Right 1153054189 18:929336-929358 AGAGTTGGGGACAGGTTTTGTGG No data
1153054184_1153054189 2 Left 1153054184 18:929311-929333 CCTCTTCTTCACAGGACTCATCA No data
Right 1153054189 18:929336-929358 AGAGTTGGGGACAGGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153054189 Original CRISPR AGAGTTGGGGACAGGTTTTG TGG Intergenic
No off target data available for this crispr