ID: 1153066145

View in Genome Browser
Species Human (GRCh38)
Location 18:1047139-1047161
Sequence ATATATAGACTCCATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153066139_1153066145 23 Left 1153066139 18:1047093-1047115 CCAGTAATGGGATTTAGAACTTT No data
Right 1153066145 18:1047139-1047161 ATATATAGACTCCATGGGGGTGG No data
1153066138_1153066145 24 Left 1153066138 18:1047092-1047114 CCCAGTAATGGGATTTAGAACTT No data
Right 1153066145 18:1047139-1047161 ATATATAGACTCCATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153066145 Original CRISPR ATATATAGACTCCATGGGGG TGG Intergenic
No off target data available for this crispr