ID: 1153075328

View in Genome Browser
Species Human (GRCh38)
Location 18:1156115-1156137
Sequence CTGAAGCCAGCAATTCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153075321_1153075328 16 Left 1153075321 18:1156076-1156098 CCCTGTAGCCACCACAGCTGGTA No data
Right 1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG No data
1153075323_1153075328 8 Left 1153075323 18:1156084-1156106 CCACCACAGCTGGTAATATGCTG No data
Right 1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG No data
1153075324_1153075328 5 Left 1153075324 18:1156087-1156109 CCACAGCTGGTAATATGCTGAGT No data
Right 1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG No data
1153075322_1153075328 15 Left 1153075322 18:1156077-1156099 CCTGTAGCCACCACAGCTGGTAA No data
Right 1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153075328 Original CRISPR CTGAAGCCAGCAATTCTTTG GGG Intergenic
No off target data available for this crispr