ID: 1153077771

View in Genome Browser
Species Human (GRCh38)
Location 18:1185012-1185034
Sequence TGAGTATCTCTTACAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153077769_1153077771 14 Left 1153077769 18:1184975-1184997 CCTATTTGATACACTGAAACAGT No data
Right 1153077771 18:1185012-1185034 TGAGTATCTCTTACAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153077771 Original CRISPR TGAGTATCTCTTACAAAAAC TGG Intergenic
No off target data available for this crispr