ID: 1153083624

View in Genome Browser
Species Human (GRCh38)
Location 18:1257408-1257430
Sequence TGTAATGGTCCCATAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153083624_1153083627 2 Left 1153083624 18:1257408-1257430 CCAATAACTATGGGACCATTACA No data
Right 1153083627 18:1257433-1257455 AGCTGCAACATATACACACTGGG No data
1153083624_1153083626 1 Left 1153083624 18:1257408-1257430 CCAATAACTATGGGACCATTACA No data
Right 1153083626 18:1257432-1257454 AAGCTGCAACATATACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153083624 Original CRISPR TGTAATGGTCCCATAGTTAT TGG (reversed) Intergenic
No off target data available for this crispr