ID: 1153085177

View in Genome Browser
Species Human (GRCh38)
Location 18:1278179-1278201
Sequence TTTATGGTCTGCTCTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153085177_1153085185 23 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085185 18:1278225-1278247 TTCAGAAGGAAGTCTTGAGAGGG No data
1153085177_1153085184 22 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data
1153085177_1153085182 9 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085182 18:1278211-1278233 GCTCCAGGCAGATCTTCAGAAGG No data
1153085177_1153085186 24 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085186 18:1278226-1278248 TCAGAAGGAAGTCTTGAGAGGGG No data
1153085177_1153085180 -6 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085180 18:1278196-1278218 CATAAAGGCCAGAACGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153085177 Original CRISPR TTTATGGTCTGCTCTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr