ID: 1153085181

View in Genome Browser
Species Human (GRCh38)
Location 18:1278204-1278226
Sequence AAGATCTGCCTGGAGCGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153085181_1153085187 7 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085187 18:1278234-1278256 AAGTCTTGAGAGGGGATGCAAGG No data
1153085181_1153085185 -2 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085185 18:1278225-1278247 TTCAGAAGGAAGTCTTGAGAGGG No data
1153085181_1153085189 24 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085189 18:1278251-1278273 GCAAGGAGGAAACAGACTCTAGG No data
1153085181_1153085186 -1 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085186 18:1278226-1278248 TCAGAAGGAAGTCTTGAGAGGGG No data
1153085181_1153085184 -3 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data
1153085181_1153085188 10 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085188 18:1278237-1278259 TCTTGAGAGGGGATGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153085181 Original CRISPR AAGATCTGCCTGGAGCGTTC TGG (reversed) Intergenic
No off target data available for this crispr