ID: 1153085184

View in Genome Browser
Species Human (GRCh38)
Location 18:1278224-1278246
Sequence CTTCAGAAGGAAGTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153085176_1153085184 23 Left 1153085176 18:1278178-1278200 CCCACTGAGAGAGCAGACCATAA No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data
1153085177_1153085184 22 Left 1153085177 18:1278179-1278201 CCACTGAGAGAGCAGACCATAAA No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data
1153085181_1153085184 -3 Left 1153085181 18:1278204-1278226 CCAGAACGCTCCAGGCAGATCTT No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data
1153085179_1153085184 6 Left 1153085179 18:1278195-1278217 CCATAAAGGCCAGAACGCTCCAG No data
Right 1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153085184 Original CRISPR CTTCAGAAGGAAGTCTTGAG AGG Intergenic
No off target data available for this crispr