ID: 1153089704

View in Genome Browser
Species Human (GRCh38)
Location 18:1330131-1330153
Sequence AGTTAACTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153089704_1153089712 22 Left 1153089704 18:1330131-1330153 CCTGCCATCTTCTGCAGTTAACT No data
Right 1153089712 18:1330176-1330198 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1153089704_1153089711 16 Left 1153089704 18:1330131-1330153 CCTGCCATCTTCTGCAGTTAACT No data
Right 1153089711 18:1330170-1330192 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1153089704_1153089708 4 Left 1153089704 18:1330131-1330153 CCTGCCATCTTCTGCAGTTAACT No data
Right 1153089708 18:1330158-1330180 CCCTTTCGAGAGACAGCTCTTGG No data
1153089704_1153089710 15 Left 1153089704 18:1330131-1330153 CCTGCCATCTTCTGCAGTTAACT No data
Right 1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1153089704_1153089713 25 Left 1153089704 18:1330131-1330153 CCTGCCATCTTCTGCAGTTAACT No data
Right 1153089713 18:1330179-1330201 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153089704 Original CRISPR AGTTAACTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr