ID: 1153089862

View in Genome Browser
Species Human (GRCh38)
Location 18:1331191-1331213
Sequence CTCTGTCCTTTCCATGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153089862_1153089865 -8 Left 1153089862 18:1331191-1331213 CCTCCATCATGGAAAGGACAGAG No data
Right 1153089865 18:1331206-1331228 GGACAGAGGTTTGTCCTCACTGG No data
1153089862_1153089867 16 Left 1153089862 18:1331191-1331213 CCTCCATCATGGAAAGGACAGAG No data
Right 1153089867 18:1331230-1331252 ATAGACACCTACTCCAGATATGG No data
1153089862_1153089868 17 Left 1153089862 18:1331191-1331213 CCTCCATCATGGAAAGGACAGAG No data
Right 1153089868 18:1331231-1331253 TAGACACCTACTCCAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153089862 Original CRISPR CTCTGTCCTTTCCATGATGG AGG (reversed) Intergenic
No off target data available for this crispr