ID: 1153097780

View in Genome Browser
Species Human (GRCh38)
Location 18:1427805-1427827
Sequence TGCAAAGCTGGCCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153097780_1153097785 22 Left 1153097780 18:1427805-1427827 CCCTGTGCAGGGCCAGCTTTGCA No data
Right 1153097785 18:1427850-1427872 CACAGTTCCCGGCACTTAGAAGG No data
1153097780_1153097784 11 Left 1153097780 18:1427805-1427827 CCCTGTGCAGGGCCAGCTTTGCA No data
Right 1153097784 18:1427839-1427861 TGTATGATTTACACAGTTCCCGG No data
1153097780_1153097786 23 Left 1153097780 18:1427805-1427827 CCCTGTGCAGGGCCAGCTTTGCA No data
Right 1153097786 18:1427851-1427873 ACAGTTCCCGGCACTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153097780 Original CRISPR TGCAAAGCTGGCCCTGCACA GGG (reversed) Intergenic
No off target data available for this crispr