ID: 1153101844

View in Genome Browser
Species Human (GRCh38)
Location 18:1480539-1480561
Sequence TGTCAAGGCCAGGACCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153101844_1153101858 21 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101858 18:1480583-1480605 AATTTGAGATAAGATTTGGGTGG 0: 41
1: 767
2: 2612
3: 10960
4: 13106
1153101844_1153101857 18 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101844_1153101856 17 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101856 18:1480579-1480601 TTACAATTTGAGATAAGATTTGG 0: 51
1: 820
2: 2359
3: 5549
4: 12696
1153101844_1153101854 -7 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101844_1153101853 -8 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101853 18:1480554-1480576 CCTTGACACCTGGGGATTATGGG 0: 18
1: 378
2: 1519
3: 2521
4: 3369
1153101844_1153101859 22 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101859 18:1480584-1480606 ATTTGAGATAAGATTTGGGTGGG 0: 37
1: 800
2: 2500
3: 10970
4: 13042
1153101844_1153101851 -9 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153101844 Original CRISPR TGTCAAGGCCAGGACCTGGT GGG (reversed) Intergenic
No off target data available for this crispr