ID: 1153101851

View in Genome Browser
Species Human (GRCh38)
Location 18:1480553-1480575
Sequence GCCTTGACACCTGGGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153101844_1153101851 -9 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101837_1153101851 14 Left 1153101837 18:1480516-1480538 CCACCCCAATGATGTAATCACCT No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101843_1153101851 -6 Left 1153101843 18:1480536-1480558 CCTCCCACCAGGTCCTGGCCTTG No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101845_1153101851 -10 Left 1153101845 18:1480540-1480562 CCACCAGGTCCTGGCCTTGACAC No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101840_1153101851 9 Left 1153101840 18:1480521-1480543 CCAATGATGTAATCACCTCCCAC No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101839_1153101851 10 Left 1153101839 18:1480520-1480542 CCCAATGATGTAATCACCTCCCA No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data
1153101838_1153101851 11 Left 1153101838 18:1480519-1480541 CCCCAATGATGTAATCACCTCCC No data
Right 1153101851 18:1480553-1480575 GCCTTGACACCTGGGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153101851 Original CRISPR GCCTTGACACCTGGGGATTA TGG Intergenic
No off target data available for this crispr