ID: 1153101854

View in Genome Browser
Species Human (GRCh38)
Location 18:1480555-1480577
Sequence CTTGACACCTGGGGATTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2749
Summary {0: 15, 1: 325, 2: 766, 3: 846, 4: 797}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153101839_1153101854 12 Left 1153101839 18:1480520-1480542 CCCAATGATGTAATCACCTCCCA No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101844_1153101854 -7 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101843_1153101854 -4 Left 1153101843 18:1480536-1480558 CCTCCCACCAGGTCCTGGCCTTG No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101838_1153101854 13 Left 1153101838 18:1480519-1480541 CCCCAATGATGTAATCACCTCCC No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101845_1153101854 -8 Left 1153101845 18:1480540-1480562 CCACCAGGTCCTGGCCTTGACAC No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101840_1153101854 11 Left 1153101840 18:1480521-1480543 CCAATGATGTAATCACCTCCCAC No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797
1153101837_1153101854 16 Left 1153101837 18:1480516-1480538 CCACCCCAATGATGTAATCACCT No data
Right 1153101854 18:1480555-1480577 CTTGACACCTGGGGATTATGGGG 0: 15
1: 325
2: 766
3: 846
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153101854 Original CRISPR CTTGACACCTGGGGATTATG GGG Intergenic
Too many off-targets to display for this crispr