ID: 1153101857

View in Genome Browser
Species Human (GRCh38)
Location 18:1480580-1480602
Sequence TACAATTTGAGATAAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26216
Summary {0: 53, 1: 838, 2: 2688, 3: 10242, 4: 12395}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153101846_1153101857 14 Left 1153101846 18:1480543-1480565 CCAGGTCCTGGCCTTGACACCTG No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101852_1153101857 3 Left 1153101852 18:1480554-1480576 CCTTGACACCTGGGGATTATGGG 0: 34
1: 973
2: 2360
3: 3451
4: 5607
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101850_1153101857 8 Left 1153101850 18:1480549-1480571 CCTGGCCTTGACACCTGGGGATT No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101843_1153101857 21 Left 1153101843 18:1480536-1480558 CCTCCCACCAGGTCCTGGCCTTG No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101844_1153101857 18 Left 1153101844 18:1480539-1480561 CCCACCAGGTCCTGGCCTTGACA No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101845_1153101857 17 Left 1153101845 18:1480540-1480562 CCACCAGGTCCTGGCCTTGACAC No data
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395
1153101855_1153101857 -5 Left 1153101855 18:1480562-1480584 CCTGGGGATTATGGGGATTACAA 0: 28
1: 32
2: 62
3: 80
4: 201
Right 1153101857 18:1480580-1480602 TACAATTTGAGATAAGATTTGGG 0: 53
1: 838
2: 2688
3: 10242
4: 12395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153101857 Original CRISPR TACAATTTGAGATAAGATTT GGG Intergenic
Too many off-targets to display for this crispr