ID: 1153106749

View in Genome Browser
Species Human (GRCh38)
Location 18:1536802-1536824
Sequence TCATAGGTATGAAGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153106749_1153106758 24 Left 1153106749 18:1536802-1536824 CCATATTCCCTTCATACCTATGA No data
Right 1153106758 18:1536849-1536871 TGAACATCTTTGGGTCCTGAAGG No data
1153106749_1153106759 25 Left 1153106749 18:1536802-1536824 CCATATTCCCTTCATACCTATGA No data
Right 1153106759 18:1536850-1536872 GAACATCTTTGGGTCCTGAAGGG No data
1153106749_1153106756 14 Left 1153106749 18:1536802-1536824 CCATATTCCCTTCATACCTATGA No data
Right 1153106756 18:1536839-1536861 CCATCAAAAATGAACATCTTTGG No data
1153106749_1153106757 15 Left 1153106749 18:1536802-1536824 CCATATTCCCTTCATACCTATGA No data
Right 1153106757 18:1536840-1536862 CATCAAAAATGAACATCTTTGGG No data
1153106749_1153106760 26 Left 1153106749 18:1536802-1536824 CCATATTCCCTTCATACCTATGA No data
Right 1153106760 18:1536851-1536873 AACATCTTTGGGTCCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153106749 Original CRISPR TCATAGGTATGAAGGGAATA TGG (reversed) Intergenic
No off target data available for this crispr