ID: 1153108274

View in Genome Browser
Species Human (GRCh38)
Location 18:1553024-1553046
Sequence CTAAAATTCTTACACTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153108273_1153108274 4 Left 1153108273 18:1552997-1553019 CCTGTTGTGGACAAGAATGTAGA No data
Right 1153108274 18:1553024-1553046 CTAAAATTCTTACACTGTGTAGG No data
1153108272_1153108274 5 Left 1153108272 18:1552996-1553018 CCCTGTTGTGGACAAGAATGTAG No data
Right 1153108274 18:1553024-1553046 CTAAAATTCTTACACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153108274 Original CRISPR CTAAAATTCTTACACTGTGT AGG Intergenic
No off target data available for this crispr