ID: 1153108810

View in Genome Browser
Species Human (GRCh38)
Location 18:1559966-1559988
Sequence TTTTGGTGGTGGCCTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153108810_1153108820 28 Left 1153108810 18:1559966-1559988 CCCTCTGGAGGCCACCACCAAAA No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153108810 Original CRISPR TTTTGGTGGTGGCCTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr