ID: 1153108811

View in Genome Browser
Species Human (GRCh38)
Location 18:1559967-1559989
Sequence ATTTTGGTGGTGGCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153108811_1153108820 27 Left 1153108811 18:1559967-1559989 CCTCTGGAGGCCACCACCAAAAT No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153108811 Original CRISPR ATTTTGGTGGTGGCCTCCAG AGG (reversed) Intergenic
No off target data available for this crispr