ID: 1153108815

View in Genome Browser
Species Human (GRCh38)
Location 18:1559977-1559999
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153108815_1153108820 17 Left 1153108815 18:1559977-1559999 CCACCACCAAAATGGGCTCAGGA No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153108815 Original CRISPR TCCTGAGCCCATTTTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr