ID: 1153108820

View in Genome Browser
Species Human (GRCh38)
Location 18:1560017-1560039
Sequence GCTCAGAGCAGACAGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153108815_1153108820 17 Left 1153108815 18:1559977-1559999 CCACCACCAAAATGGGCTCAGGA No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data
1153108817_1153108820 11 Left 1153108817 18:1559983-1560005 CCAAAATGGGCTCAGGACAGAAC No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data
1153108811_1153108820 27 Left 1153108811 18:1559967-1559989 CCTCTGGAGGCCACCACCAAAAT No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data
1153108810_1153108820 28 Left 1153108810 18:1559966-1559988 CCCTCTGGAGGCCACCACCAAAA No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data
1153108816_1153108820 14 Left 1153108816 18:1559980-1560002 CCACCAAAATGGGCTCAGGACAG No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data
1153108809_1153108820 29 Left 1153108809 18:1559965-1559987 CCCCTCTGGAGGCCACCACCAAA No data
Right 1153108820 18:1560017-1560039 GCTCAGAGCAGACAGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153108820 Original CRISPR GCTCAGAGCAGACAGCTCTA TGG Intergenic
No off target data available for this crispr