ID: 1153131269

View in Genome Browser
Species Human (GRCh38)
Location 18:1857693-1857715
Sequence TAGGCTGTTACACTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131269_1153131278 24 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131269_1153131274 3 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131274 18:1857719-1857741 GCTGTCTCCCAAAAGGAGAATGG No data
1153131269_1153131279 25 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG No data
1153131269_1153131277 20 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131277 18:1857736-1857758 GAATGGTTATCTGTAGAAGATGG No data
1153131269_1153131273 -4 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131273 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131269 Original CRISPR TAGGCTGTTACACTGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr