ID: 1153131270

View in Genome Browser
Species Human (GRCh38)
Location 18:1857699-1857721
Sequence AGCTCTTAGGCTGTTACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131270_1153131274 -3 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131274 18:1857719-1857741 GCTGTCTCCCAAAAGGAGAATGG No data
1153131270_1153131277 14 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131277 18:1857736-1857758 GAATGGTTATCTGTAGAAGATGG No data
1153131270_1153131273 -10 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131273 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
1153131270_1153131279 19 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG No data
1153131270_1153131278 18 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131270 Original CRISPR AGCTCTTAGGCTGTTACACT GGG (reversed) Intergenic
No off target data available for this crispr