ID: 1153131272

View in Genome Browser
Species Human (GRCh38)
Location 18:1857712-1857734
Sequence CCTTTTGGGAGACAGCTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131272_1153131280 28 Left 1153131272 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
Right 1153131280 18:1857763-1857785 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240
1153131272_1153131277 1 Left 1153131272 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
Right 1153131277 18:1857736-1857758 GAATGGTTATCTGTAGAAGATGG No data
1153131272_1153131278 5 Left 1153131272 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131272_1153131279 6 Left 1153131272 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
Right 1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131272 Original CRISPR CCTTTTGGGAGACAGCTCTT AGG (reversed) Intergenic
No off target data available for this crispr