ID: 1153131275

View in Genome Browser
Species Human (GRCh38)
Location 18:1857726-1857748
Sequence CAGATAACCATTCTCCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131275_1153131279 -8 Left 1153131275 18:1857726-1857748 CCCAAAAGGAGAATGGTTATCTG No data
Right 1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG No data
1153131275_1153131278 -9 Left 1153131275 18:1857726-1857748 CCCAAAAGGAGAATGGTTATCTG No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131275_1153131280 14 Left 1153131275 18:1857726-1857748 CCCAAAAGGAGAATGGTTATCTG No data
Right 1153131280 18:1857763-1857785 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131275 Original CRISPR CAGATAACCATTCTCCTTTT GGG (reversed) Intergenic
No off target data available for this crispr