ID: 1153131278

View in Genome Browser
Species Human (GRCh38)
Location 18:1857740-1857762
Sequence GGTTATCTGTAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131275_1153131278 -9 Left 1153131275 18:1857726-1857748 CCCAAAAGGAGAATGGTTATCTG No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131270_1153131278 18 Left 1153131270 18:1857699-1857721 CCCAGTGTAACAGCCTAAGAGCT No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131276_1153131278 -10 Left 1153131276 18:1857727-1857749 CCAAAAGGAGAATGGTTATCTGT No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131269_1153131278 24 Left 1153131269 18:1857693-1857715 CCAAAGCCCAGTGTAACAGCCTA No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131268_1153131278 27 Left 1153131268 18:1857690-1857712 CCACCAAAGCCCAGTGTAACAGC No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131271_1153131278 17 Left 1153131271 18:1857700-1857722 CCAGTGTAACAGCCTAAGAGCTG No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data
1153131272_1153131278 5 Left 1153131272 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG No data
Right 1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131278 Original CRISPR GGTTATCTGTAGAAGATGGC AGG Intergenic
No off target data available for this crispr