ID: 1153131922

View in Genome Browser
Species Human (GRCh38)
Location 18:1863653-1863675
Sequence CTCTACAGTGAAGCGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131922_1153131924 16 Left 1153131922 18:1863653-1863675 CCAGACAACGCTTCACTGTAGAG No data
Right 1153131924 18:1863692-1863714 ACTGTACTAGTGAATGTGTAGGG No data
1153131922_1153131923 15 Left 1153131922 18:1863653-1863675 CCAGACAACGCTTCACTGTAGAG No data
Right 1153131923 18:1863691-1863713 CACTGTACTAGTGAATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131922 Original CRISPR CTCTACAGTGAAGCGTTGTC TGG (reversed) Intergenic
No off target data available for this crispr