ID: 1153131923

View in Genome Browser
Species Human (GRCh38)
Location 18:1863691-1863713
Sequence CACTGTACTAGTGAATGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153131921_1153131923 16 Left 1153131921 18:1863652-1863674 CCCAGACAACGCTTCACTGTAGA No data
Right 1153131923 18:1863691-1863713 CACTGTACTAGTGAATGTGTAGG No data
1153131920_1153131923 22 Left 1153131920 18:1863646-1863668 CCTAAGCCCAGACAACGCTTCAC No data
Right 1153131923 18:1863691-1863713 CACTGTACTAGTGAATGTGTAGG No data
1153131922_1153131923 15 Left 1153131922 18:1863653-1863675 CCAGACAACGCTTCACTGTAGAG No data
Right 1153131923 18:1863691-1863713 CACTGTACTAGTGAATGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153131923 Original CRISPR CACTGTACTAGTGAATGTGT AGG Intergenic
No off target data available for this crispr