ID: 1153133245

View in Genome Browser
Species Human (GRCh38)
Location 18:1882085-1882107
Sequence TTACCTGTGATGGCTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153133239_1153133245 0 Left 1153133239 18:1882062-1882084 CCTTTTTTCAACCCTTCCTCGTT No data
Right 1153133245 18:1882085-1882107 TTACCTGTGATGGCTGGAACTGG No data
1153133238_1153133245 10 Left 1153133238 18:1882052-1882074 CCTTTAATTGCCTTTTTTCAACC No data
Right 1153133245 18:1882085-1882107 TTACCTGTGATGGCTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153133245 Original CRISPR TTACCTGTGATGGCTGGAAC TGG Intergenic
No off target data available for this crispr