ID: 1153134560

View in Genome Browser
Species Human (GRCh38)
Location 18:1899857-1899879
Sequence ATTATTTTCTTCCTTCTTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153134560_1153134561 3 Left 1153134560 18:1899857-1899879 CCGTTAAGAAGGAAGAAAATAAT No data
Right 1153134561 18:1899883-1899905 AAAACGAATAATATTCCAGTTGG No data
1153134560_1153134563 16 Left 1153134560 18:1899857-1899879 CCGTTAAGAAGGAAGAAAATAAT No data
Right 1153134563 18:1899896-1899918 TTCCAGTTGGGTGATGTGTAAGG No data
1153134560_1153134564 17 Left 1153134560 18:1899857-1899879 CCGTTAAGAAGGAAGAAAATAAT No data
Right 1153134564 18:1899897-1899919 TCCAGTTGGGTGATGTGTAAGGG No data
1153134560_1153134562 4 Left 1153134560 18:1899857-1899879 CCGTTAAGAAGGAAGAAAATAAT No data
Right 1153134562 18:1899884-1899906 AAACGAATAATATTCCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153134560 Original CRISPR ATTATTTTCTTCCTTCTTAA CGG (reversed) Intergenic
No off target data available for this crispr