ID: 1153134564

View in Genome Browser
Species Human (GRCh38)
Location 18:1899897-1899919
Sequence TCCAGTTGGGTGATGTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153134560_1153134564 17 Left 1153134560 18:1899857-1899879 CCGTTAAGAAGGAAGAAAATAAT No data
Right 1153134564 18:1899897-1899919 TCCAGTTGGGTGATGTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153134564 Original CRISPR TCCAGTTGGGTGATGTGTAA GGG Intergenic
No off target data available for this crispr