ID: 1153142262

View in Genome Browser
Species Human (GRCh38)
Location 18:1986630-1986652
Sequence GATTTTCTTCTAGGGTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153142262_1153142267 7 Left 1153142262 18:1986630-1986652 CCTTTAAACCCTAGAAGAAAATC No data
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data
1153142262_1153142268 8 Left 1153142262 18:1986630-1986652 CCTTTAAACCCTAGAAGAAAATC No data
Right 1153142268 18:1986661-1986683 ATGATTCAGAATATAGGCATGGG No data
1153142262_1153142266 2 Left 1153142262 18:1986630-1986652 CCTTTAAACCCTAGAAGAAAATC No data
Right 1153142266 18:1986655-1986677 GGCAATATGATTCAGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153142262 Original CRISPR GATTTTCTTCTAGGGTTTAA AGG (reversed) Intergenic
No off target data available for this crispr