ID: 1153142264

View in Genome Browser
Species Human (GRCh38)
Location 18:1986638-1986660
Sequence ATTGCCTAGATTTTCTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25499
Summary {0: 672, 1: 8963, 2: 10369, 3: 3555, 4: 1940}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153142264_1153142268 0 Left 1153142264 18:1986638-1986660 CCCTAGAAGAAAATCTAGGCAAT 0: 672
1: 8963
2: 10369
3: 3555
4: 1940
Right 1153142268 18:1986661-1986683 ATGATTCAGAATATAGGCATGGG No data
1153142264_1153142267 -1 Left 1153142264 18:1986638-1986660 CCCTAGAAGAAAATCTAGGCAAT 0: 672
1: 8963
2: 10369
3: 3555
4: 1940
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data
1153142264_1153142266 -6 Left 1153142264 18:1986638-1986660 CCCTAGAAGAAAATCTAGGCAAT 0: 672
1: 8963
2: 10369
3: 3555
4: 1940
Right 1153142266 18:1986655-1986677 GGCAATATGATTCAGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153142264 Original CRISPR ATTGCCTAGATTTTCTTCTA GGG (reversed) Intergenic
Too many off-targets to display for this crispr