ID: 1153142265

View in Genome Browser
Species Human (GRCh38)
Location 18:1986639-1986661
Sequence TATTGCCTAGATTTTCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28490
Summary {0: 717, 1: 9317, 2: 11016, 3: 4541, 4: 2899}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153142265_1153142268 -1 Left 1153142265 18:1986639-1986661 CCTAGAAGAAAATCTAGGCAATA 0: 717
1: 9317
2: 11016
3: 4541
4: 2899
Right 1153142268 18:1986661-1986683 ATGATTCAGAATATAGGCATGGG No data
1153142265_1153142267 -2 Left 1153142265 18:1986639-1986661 CCTAGAAGAAAATCTAGGCAATA 0: 717
1: 9317
2: 11016
3: 4541
4: 2899
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data
1153142265_1153142266 -7 Left 1153142265 18:1986639-1986661 CCTAGAAGAAAATCTAGGCAATA 0: 717
1: 9317
2: 11016
3: 4541
4: 2899
Right 1153142266 18:1986655-1986677 GGCAATATGATTCAGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153142265 Original CRISPR TATTGCCTAGATTTTCTTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr