ID: 1153142267

View in Genome Browser
Species Human (GRCh38)
Location 18:1986660-1986682
Sequence TATGATTCAGAATATAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153142264_1153142267 -1 Left 1153142264 18:1986638-1986660 CCCTAGAAGAAAATCTAGGCAAT 0: 672
1: 8963
2: 10369
3: 3555
4: 1940
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data
1153142265_1153142267 -2 Left 1153142265 18:1986639-1986661 CCTAGAAGAAAATCTAGGCAATA 0: 717
1: 9317
2: 11016
3: 4541
4: 2899
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data
1153142262_1153142267 7 Left 1153142262 18:1986630-1986652 CCTTTAAACCCTAGAAGAAAATC No data
Right 1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153142267 Original CRISPR TATGATTCAGAATATAGGCA TGG Intergenic
No off target data available for this crispr