ID: 1153142729

View in Genome Browser
Species Human (GRCh38)
Location 18:1993417-1993439
Sequence CACAAAGAACTCCCTTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153142727_1153142729 16 Left 1153142727 18:1993378-1993400 CCTAGATATTTATCCAAGAATAA No data
Right 1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG No data
1153142728_1153142729 3 Left 1153142728 18:1993391-1993413 CCAAGAATAATGAAAATATATTT No data
Right 1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153142729 Original CRISPR CACAAAGAACTCCCTTCAAA TGG Intergenic
No off target data available for this crispr