ID: 1153147492

View in Genome Browser
Species Human (GRCh38)
Location 18:2050377-2050399
Sequence CAGGCTAGTAAAGCTATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153147489_1153147492 3 Left 1153147489 18:2050351-2050373 CCTTATTGGGTGTTCAGAGTTGC No data
Right 1153147492 18:2050377-2050399 CAGGCTAGTAAAGCTATGGCTGG No data
1153147488_1153147492 13 Left 1153147488 18:2050341-2050363 CCTTTAGAATCCTTATTGGGTGT No data
Right 1153147492 18:2050377-2050399 CAGGCTAGTAAAGCTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153147492 Original CRISPR CAGGCTAGTAAAGCTATGGC TGG Intergenic
No off target data available for this crispr